Holothuria difficilis

Semper, 1868 · species

image placeholder — illustration coming later

Animalia/Echinodermata/Holothuroidea/Holothuriida/Holothuriidae/Holothuria

At a glance

Occurrence records536

Data sources8

Biological traits2

DNA specimens13

eDNA detections9

Sources8 archives

Databases and archives Holothuria difficilis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility536 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF536 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD13 specimens

01Narrative

Holothuria (Platyperona) difficilis is a species of sea cucumber in the family Holothuriidae."WoRMS - World Register of Marine Species - Holothuria (Platyperona) difficilis Semper, 1868". www.marinespecies.org. Retrieved 2022-4-24. Holothuria comes from Latin but is originally taken from Greek. Its meaning is a plantlike animal whose origin is uncertain.“Holothurian Definition & Meaning.” Merriam-Webster, Merriam-Webster, https://www.merriam-webster.com/dictionary/holothurian.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Holothuria difficilis has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

eDNA detections9

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P634 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.

Where individuals differ — all 125 variable positions, in barcode order

8Tmostly conserved

10Amostly conserved

13Cmostly conserved

16Amostly conserved

17Cmostly conserved

19Cmostly conserved

28Cmostly conserved

31Tmostly conserved

43Tmostly conserved

49Amostly conserved

61Cmostly conserved

67Cmostly conserved

70Cmostly conserved

74Tmostly conserved

85Amostly conserved

91Cmostly conserved

95Cmostly conserved

97Cmostly conserved

100Cmostly conserved

101Tmostly conserved

109Cmostly conserved

112Tmostly conserved

115Amostly conserved

123Gmostly conserved

127Amostly conserved

129Cmostly conserved

130Amostly conserved

133Amostly conserved

136Tmostly conserved

139Gmostly conserved

145Amostly conserved

151Cmostly conserved

154Amostly conserved

157Tmostly conserved

163Tmostly conserved

169Cmostly conserved

172Amostly conserved

175Amostly conserved

181Tmostly conserved

187Amostly conserved

190Amostly conserved

193Amostly conserved

196Tmostly conserved

199Tmostly conserved

202Tmostly conserved

205Tmostly conserved

208Tmostly conserved

211Tmostly conserved

218Tmostly conserved

223Amostly conserved

226Tmostly conserved

235Cmostly conserved

238Tmostly conserved

239Tmostly conserved

244Tmostly conserved

259Tmostly conserved

262Tmostly conserved

265Cmostly conserved

271Cmostly conserved

274Cmostly conserved

283Tmostly conserved

286Amostly conserved

289Amostly conserved

292Amostly conserved

295Cmostly conserved

298Tmostly conserved

304Gmostly conserved

310Gmostly conserved

313Gmostly conserved

316Tmostly conserved

319Amostly conserved

322Amostly conserved

325Amostly conserved

328Amostly conserved

331Tmostly conserved

337Amostly conserved

343Cmostly conserved

346Amostly conserved

358Tmostly conserved

361Cmostly conserved

364Amostly conserved

367Tmostly conserved

373Amostly conserved

376Amostly conserved

379Tmostly conserved

382Amostly conserved

385Tmostly conserved

391Cmostly conserved

397Amostly conserved

406Tmostly conserved

418Amostly conserved

421Tmostly conserved

424Tmostly conserved

430Tmostly conserved

436Amostly conserved

439Amostly conserved

442Amostly conserved

448Amostly conserved

451Tmostly conserved

466Amostly conserved

469Cmostly conserved

472Gmostly conserved

478Cmostly conserved

481Amostly conserved

487Tmostly conserved

493Cmostly conserved

496Tmostly conserved

506Cvariable

511Amostly conserved

514Amostly conserved

532Tmostly conserved

538Amostly conserved

550Amostly conserved

553Amostly conserved

562Gmostly conserved

565Amostly conserved

568Cmostly conserved

571Cmostly conserved

575Cmostly conserved

586Tmostly conserved

+5 more variable positions not shown

AAACTGATTAATCCCACTCATGATAGGCGCTCCAGACATGGCTTTCCCACGAATGAAAAACATGAGCTTCTGATTAGTCCCCCCATCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.2%

Haplotypes4

BINs2

Most divergent pair0.79%

AfricaAsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Holothuria atrasame genus15.9%Bathyplotes bongrainisame order16.3%Bohadschia argussame family16.6%same family16.7%Holothuria colubersame genus16.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type536 records

Wild obs. + sensor175

Museum / vouchered360

Other1

Range

Area of Occupancy AOO1 140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 52≤1 km 33≤10 km 6>10 km 7

98 georeferenced · 77 without coordinates

Open the mapobservation + sensor175

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 46≤1 km 28≤10 km 33>10 km 21

128 georeferenced · 232 without coordinates

Open the institutions mapphysical evidence360

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Ciencias del Mar y Limnología, Unidad Académica Mazatlán, Universidad Nacional Autónoma de Méxicolocation not on record	67
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	66
Sydney, AU	61
Cambridge, US	37
Washington, US	22
Universidad Católica del Nortelocation not on record	15
Universidad del Marlocation not on record	12
Brussels, BE	11
Los Angeles, US	10
CASlocation not on record	9
Western Australian Museumlocation not on record	9
RBINS-Scientific Heritagelocation not on record	7
Honolulu, US	6
Museums Victorialocation not on record	4
Natick, US	4
University of Floridalocation not on record	3
Earth Sciences New Zealandlocation not on record	2
Universidad del Valle (UniValle)location not on record	2
New Haven, US	1
University of California Museum of Paleontologylocation not on record	1
UM-RSMASlocation not on record	1
Puerto Ayora, EC	1

22 institutions · 351 of 360 vouchered records shown · 9 without an institution code

09Environmental DNA9 detections

Where the DNA of Holothuria difficilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

patch reef top

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 23.6–26.2

Seasonal swing summer↔winter3.30 °C

Max temp (day)25.0 °C 25.0–27.0

Min temp (night)22.4 °C 22.4–25.2

Precipitation50.7 mm/mo 50.7–139

Air humidity59.7 % 59.7–62.9

Vapour deficit1,166 Pa 1,166–1,258

Cloud cover33.5 % 33.5–36.1

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)