Holorusia hespera

Arnaud & Byers, 1990 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tipulidae/Holorusia

At a glance

Occurrence records1 407

Data sources6

Biological traits0

DNA specimens7

eDNA detections0

Sources6 archives

Databases and archives Holorusia hespera's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 407 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 407 records

DNA & barcodingBOLD7 specimens

01Narrative

Holorusia hespera, the giant western crane fly, is a species of crane fly in the family Tipulidae. It is found in western North America. Holorusia hespera, giant western crane fly, California

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Holorusia hespera has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.61%

Haplotypes2

BIN1

Most divergent pair0.91%

Where individuals differ — all 6 variable positions, in barcode order

22Avariable

73Gvariable

163Avariable

340Cvariable

415Avariable

616Tvariable

TACATTATATTTTATTTTTGGAGCTTGAGCCGGTATAGTTGGAACTTCATTAAGAATTTTAATTCGAGCAGAGTTAGGTCATCCCGGGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Tipula comstockianasame family9.1%Tipula coloradensissame family9.3%Tipula helvolasame family9.7%Tipula duplexsame family9.9%Tipula subprotrusasame family9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 407 records

Wild obs. + sensor1 384

Museum / vouchered23

Origin

Native1

Range

Area of Occupancy AOO4 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 856≤1 km 116≤10 km 63>10 km 134

1 169 georeferenced · 215 without coordinates

Open the mapobservation + sensor1 384

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 1≤10 km 4>10 km 5

10 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	10
US	6
Cambridge, US	3
CUlocation not on record	1
Los Angeles, US	1
Washington, US	1
Colorado State Universitylocation not on record	1

7 institutions · 23 of 23 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Holorusia hespera

At a glance

Sources6 archives

At a glance

Record type1 407 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 7 geolocated

Record type1 407 records