Hippocrepis multisiliquosa

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Hippocrepis

At a glance

Occurrence records1 379

Data sources10

Biological traits33

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Hippocrepis multisiliquosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 379 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Occurrence & distributionGBIF1 379 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Hippocrepis multisiliquosa é uma espécie de planta com flor pertencente à família Fabaceae. A autoridade científica da espécie é L., tendo sido publicada em Species Plantarum 2: 744. 1753.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Fruit length max40 mm

Fruit length min30 mm

Fruit width max4.5 mm

Fruit width min3 mm

Leaf length max12 mm

Leaf length min8 mm

Leaf width max3 mm

Leaf width min2.5 mm

Plant height0.35 m

Plant height max0.3 m

Plant height min0.08 m

Seed mass1.96 mg

Life cycle & reproduction8

DeciduousnessOther

Dehiscencedehiscent

Flower colouryellow

Flowering endMar

Flowering startMar

Life formannual

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max200 m

Elevation min0 m

Epiphyteterrestrial

Fruit typelegume

Growth formherb

Leaf formoblong

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Shoot orientationascending

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hippocrepis multisiliquosa has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSDQ642003.1 ↗610 bp

ACGT

TCGTATCCTGCAAACAATCAAACCCGTGAACTTGTTTGACTATTTTGGGTAGGATTGGGGTGTGATCCACCTCAACCTCCCATGTTAGGG …

Hippocrepis multisiliquosa internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hippocrepis multisiliquosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode21records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1421×CCDB · iber-fl · CCDB · fl-europaea · CCDB · ipcn-api-dl +5

CCDB · iber-fl — Caryologie du genre Hippocrepis L. Guern, M. & M. R. Gorenflot.C.R. Acad. Sci. Paris263: 509-512(1966).

CCDB · iber-fl — Chromosome atlas of flowering plants. Darlintong, C. D. & A. P. Wylie.*(1955).

CCDB · iber-fl — Contribucin al estudio citotaxonmico de la flora espaola. Horjales, M.Trab. Dept. Bot. Fisiol. Veg. Madrid9: 13-18(1976).

CCDB · iber-fl — Revisin de las especies anuales del gnero Hippocrepis L. Domnguez, E.Lagascalia5(2): 225-261(1976).

CCDB · fl-europaea — Lorenzo-Andreu

CCDB · ipcn-api-dl — DOMINGUEZ, E. 1976. Revision de las especies anuales del genero Hippocrepis L. Lagascalia 5: 225–261.

CCDB · ipcn-api-dl — Fernandes, A. & M. QUEIROS. 1978. Contribution à la connaissance cytotaxinomique des Spermatophyta du Portugal. IV. Leguminosee (Suppl. 3). Bol. Soc. Brot., sér. 2 52: 79–164.

CCDB · ipcn-api-dl — HORJALES, M. 1976. Contribucion al estudio citotaxonomico de la flora espanola. Trab. Dept. Bot. Univ. Complutense 9: 13–18.

CCDB · book-ipcn72 — KRAMER, K.U., L.Y TH.WESTRA, E. KLIPHUIS, & T.W.J. GADELLA. 1972. Floristic and cytotaxonomic notes on the flora of the Maltese islands. Acta Bot. Neerl. 21: 54-66 .

CCDB · book-ipcn75-78 — Hor jales 1976

CCDB · book-ipcn75-78 — Dominguez 1976

CCDB · book-ipcn75-78 — Fernandes & Queiros 1978

CCDB · book-fedorov — Lorenzo-Andreu, cia-Sanz 1950

CCDB · book-fedorov — Reese 1957

CCDB · book-fedorov — Guern, Gorenflot

CCDB · book-atlas-flowering-plants — Lorenzo-Andreu & G. H

CCDB · CromoCat 2015 — Domínguez, E. (1976). Revisión de las especies anuales del género Hippocrepis L. Lagascalia 5(2): 225-261.

CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1978a). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. IX. Cruciferae. Bol. Soc. Brot. 52: 79-164.

CCDB · CromoCat 2015 — Guern, M. & Gorenflot, M. R. (1966). Caryologie du genre Hippocrepis L. Compt. Rend. Acad. Sci. Paris 263(5): 509-512.

CCDB · CromoCat 2015 — Horjales, M. (1976). Contribución al estudio citotaxonómico de la flora española. Trab. Dept. Bot. Fisiol. Veg. Madrid 9: 13-18.

CCDB · CromoCat 2015 — Kramer, K. U., Westra, L. Y., Kliphuis, E. & Gadella, T. W. (1972). Floristic and cytotaxonomic notes on the flora of the Maltese Islands. Acta Bot. Neerl. 21: 54-66.

n 71×CCDB · Cave1957

CCDB · Cave1957 — Reese

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 379 records

Wild obs. + sensor1 025

Museum / vouchered231

Cultivated / captive13

Other110

Origin

Native27

Range

Area of Occupancy AOO3 104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 74≤1 km 102≤10 km 358>10 km 3

537 georeferenced · 488 without coordinates

Open the mapobservation + sensor1 025

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 13≤1 km 40≤10 km 47>10 km 1

101 georeferenced · 130 without coordinates

Open the institutions mapphysical evidence231

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 6>10 km 4

10 georeferenced · 3 without coordinates

Open the mapnot free-living13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	36
Barcelona, ES	24
MAlocation not on record	19
BClocation not on record	19
UIBlocation not on record	13
BDBClocation not on record	12
BIO-UNIPIlocation not on record	12
Wlocation not on record	11
CJBGlocation not on record	10
Pamplona, ES	6
South Kensington, GB	5
València, ES	5
Alicante, ES	4
Phyletisches Museum Jenalocation not on record	3
Sevilla, ES	3
Badajoz, ES	3
Entomological Society of Latvialocation not on record	3
CICYTEXlocation not on record	3
JBSlocation not on record	2
Provincia di Livornolocation not on record	2
Pamplona, ES	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Saint Louis, US	2
Berlin, DE	2
BRNUlocation not on record	2
Phoenix, US	1
Görlitz, DE	1
Moscow State Universitylocation not on record	1
ISAlocation not on record	1
Davenport, US	1
Museo Achille Folettolocation not on record	1
Salamanca, ES	1
Moscow, US	1
Chongqing Museumlocation not on record	1
EEZA-CSIClocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Rishon Le Zion, IL	1
Salzburg, AT	1
Hunan Geological Museumlocation not on record	1
Granada, ES	1
Clemson, US	1
Edinburgh, GB	1

42 institutions · 222 of 231 vouchered records shown · 9 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Hippocrepis multisiliquosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hippocrepis multisiliquosa

At a glance

Sources10 archives

Size & morphology12

Life cycle & reproduction8

Diet & foraging1

Habitat & environment10

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 379 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions20 of 42 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 379 records