Hippeastrum striatum

(Lam.) H.E.Moore · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Hippeastrum

At a glance

Occurrence records162

Data sources10

Biological traits13

DNA specimens6

eDNA detections3

Sources10 archives

Databases and archives Hippeastrum striatum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility162 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF162 records

Environmental DNA1 datasets · 2 countries3 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Hippeastrum striatum, Botanical Register 1815 Hippeastrum striatum, the striped Barbados lily, a flowering perennial herbaceous bulbous plant, in the family Amaryllidaceae, native to the southern and eastern regions of Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formbulbous geophyte

Life spanannual

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max800 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTFloresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Restinga

Woodinessnon-woody

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hippeastrum striatum has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences5

eDNA detections3

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOL536512.1 ↗363 bpUSA · 2019

ACGT

TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCTATCTGGCCAAGGGCACGCCTGCCTGGGCGTCACGCCTA …

Hippeastrum striatum voucher MO:Carlsen3391 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS3★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Hippeastrum striatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–442n range33median22mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 495×CCDB · book-fedorov · CCDB · Cave1956supp

CCDB · book-fedorov — Mookerjea 1955b

CCDB · book-fedorov — Traub 1958

CCDB · book-fedorov — Sharma A. K. 1956a

CCDB · Cave1956supp — Mookerjea 1955a

2n 224×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · kew

CCDB · ipcn-api-dl — Naranjo, C. A. & A. B. ANDRADA. 1975. El cariotipo fundamental en el genero Hippeastrum Herb. (Amaryllidaceae). Darwiniana 19: 566–582.

CCDB · book-fedorov — Snoad 1952 (D. 1955)

CCDB · kew — Poggio L, González G, Naranjo CA. 2007. Chromosome studies in Hippeastrum (Amaryllidaceae): variation in genome size. Botanical Journal of the Linnean Society 155: 171-178.

CCDB · kew — Poggio L, Realini MF, Fourastié MF, García AM, González GE. 2014. Genome downsizing and karyotype constancy in diploid and polyploid congeners: a model of genome size variation. AoB Plants 6: plu029.

2n 444×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · kew

CCDB · ipcn-api-dl — Flory, W. S. & R. F. Coulthard. 1981. New chromosome counts, numbers and types in genus Amaryllis. Pl. Life 37: 43–56.

CCDB · book-fedorov — SatO D. 1938

CCDB · book-fedorov — Sata D. 1938, 1942

2n 553×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · kew

CCDB · ipcn-api-dl — Arroyo, S. 1982. The chromosomes of Hippeastrum, Amaryllis and Phycella (Amaryllidaceae). Kew Bull. 37: 211–216.

CCDB · book-ipcn67-71 — NARANJO, C.A. 1969. Cariotipos de nueve especies Argentinas de Rhodophiala, Hippeastrum, Zephyranthes, y Habranthus (Amaryllidaceael. Kurtziana 5: 67-87.

2n 331×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Zou, Q. l. & Z. x. Qin. 1994. The karyotype analysis of Hippeastrum rutilum. Guihaia 14(1): 37–38.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type162 records

Wild obs. + sensor65

Museum / vouchered96

Other1

Origin

Native18

Range

Area of Occupancy AOO492 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy11% within 1 km

≤100 m 3≤1 km 4>10 km 54

61 georeferenced · 4 without coordinates

Open the mapobservation + sensor65

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 9

9 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence96

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Jose State University, Museum of Birds and Mammalslocation not on record	8
JBRJlocation not on record	8
Honolulu, US	7
BISHlocation not on record	6
Bronx, US	5
Blumenau, BR	5
University of Stellenboschlocation not on record	4
HUENFlocation not on record	4
Cascavel, BR	4
UTFPR-CPlocation not on record	3
UFPRlocation not on record	3
Campo Mourão, BR	2
Université de Bordeauxlocation not on record	2
Buenos Aires, AR	2
Porto Alegre, BR	2
Ivano-Frankivsk, UA	2
Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record	1
UFMGlocation not on record	1
Departamento de Geologia, Universidad de Chilelocation not on record	1
Criciúma, BR	1
Foz do Iguaçu, BR	1
UERJlocation not on record	1
Universidade Federal de Juiz de Foralocation not on record	1
Federal University of Espírito Santolocation not on record	1
UFMSlocation not on record	1
Salvador, BR	1
Saint Louis, US	1
San Isidro, AR	1
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	1
UNICAMPlocation not on record	1
IPA/SPlocation not on record	1
UESBlocation not on record	1
Corrientes, AR	1
Cenargenlocation not on record	1
Universidade Federale do Rio Grande do Sullocation not on record	1
UFESlocation not on record	1
UNESP-RClocation not on record	1
UTFPR-SLlocation not on record	1
Campo Grande, BR	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
UNESClocation not on record	1

42 institutions · 93 of 96 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Hippeastrum striatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.3 °C 2.00–22.5

Seasonal swing summer↔winter14.2 °C

Max temp (day)17.4 °C 7.20–27.6

Min temp (night)8.60 °C -1.50–18.7

Precipitation115 mm/mo 75.4–154

Air humidity61.3 % 59.2–63.5

Moisture balance33.2 mm/mo 32.9–33.4

Vapour deficit700 Pa 337–1,063

Wind speed2.50 m/s 1.40–3.50

Cloud cover46.7 % 46.1–47.3

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)