Hippeastrum psittacinum

(Ker Gawl.) Herb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Hippeastrum

At a glance

Occurrence records31

Data sources11

Biological traits16

DNA specimens3

eDNA detections3

Sources11 archives

Databases and archives Hippeastrum psittacinum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility31 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Occurrence & distributionGBIF31 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT15.3 Gbp

01Narrative

Amaryllis psittacina. Botanical RegisterBotanical Register; Consisting of Coloured Figures of Exotic Plants Cultivated in British Gardens; with their History and Mode of Treatment. London 3: t. 199. 1817 Hippeastrum psittacinum (Parrot Amaryllis) is a flowering perennial herbaceous bulbous plant, in the family Amaryllidaceae, native to Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max800 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTFloresta Estacional Semidecidual, Vegetação Sobre Afloramentos Rochosos

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry2

Leaf n44.55 mg/g

Photosynthetic pathwayC3

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hippeastrum psittacinum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKC207437.1 ↗645 bpBrazil

ACGT

TAGAGGCCCGAACGGACGATCGCGAACTTGTAGAGCAACCGTAGTGGGCGGTAGGGGGCGGCGATCGCCGTCTGCCTTCGCCTGCTTGGG …

Hippeastrum psittacinum voucher NA:Meerow 1305 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Hippeastrum psittacinum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size15 320 370 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Hippeastrum psittacinum15.32 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–222n range22median22mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 227×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · iapt +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Williams, M. 1982. A tetraploid Amaryllis starkii. Pl. Life 38: 59–60.

CCDB · ipcn-api-dl — Arroyo, S. 1982. The chromosomes of Hippeastrum, Amaryllis and Phycella (Amaryllidaceae). Kew Bull. 37: 211–216.

CCDB · ipcn-api-dl — Guerra, M. d. S. 1986. Citogenetica de Angiospermas coletadas en Pernambuco, I. Revista Brasil. Genét. 9: 21–40.

CCDB · ipcn-api-dl — Dutilh, J. H. A. 1989. Morphological variation in a population of Hippeastrum Herb. Herbertia 45: 152–155.

CCDB · iapt — IAPT/IOPB Chromosome Data 18

CCDB · kew — Poggio L, González G, Naranjo CA. 2007. Chromosome studies in Hippeastrum (Amaryllidaceae): variation in genome size. Botanical Journal of the Linnean Society 155: 171-178.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type31 records

Wild obs. + sensor1

Museum / vouchered30

Origin

Native6

Range

Area of Occupancy AOO84 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 29 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidade Federal de Juiz de Foralocation not on record	6
San Jose State University, Museum of Birds and Mammalslocation not on record	6
Stockholm, SE	3
Campo Mourão, BR	3
UTFPR-CPlocation not on record	3
Bogotá, D.C., CO	2
UFPElocation not on record	1
Bronx, US	1
Kew, GB	1
UNICAMPlocation not on record	1
Pontifícia Universidade Católica do Paranálocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1

12 institutions · 29 of 30 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Hippeastrum psittacinum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)30.2 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity64.0 %

Moisture balance32.9 mm/mo

Vapour deficit1,154 Pa

Wind speed1.10 m/s

Cloud cover45.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)