Hippeastrum papilio

(Ravenna) Van Scheepen · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Hippeastrum

At a glance

Occurrence records16

Data sources11

Biological traits14

DNA specimens5

eDNA detections5

Sources11 archives

Databases and archives Hippeastrum papilio's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionLOTUS · NPASS54 compounds

Occurrence & distributionGBIF16 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Butterfly Amaryllis Hippeastrum papilio is a flowering perennial herbaceous bulbous plant, in the family Amaryllidaceae, native to southern Brasil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formepiphyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max800 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTFloresta Estacional Semidecidual

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition54 compounds

Compounds documented for Hippeastrum papilio across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols18

Labdane diterpenoids9

Amarylidaceae alkaloids $ Isoquinoline alkaloids4

Amarylidaceae alkaloids4

Norlabdane diterpenoids3

Documented compounds54 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Vittatine	present	LOTUS
(-)-8-Demethylmaritidine	present	LOTUS
(-)-Galantamine	present	LOTUS
(3aS,5aR,9aS,9bR)-3a,6,6,9a-tetramethyl-2,4,5,5a,7,8,9,9b-octahydro-1H-benzo[e][1]benzofuran	present	NPASS
(3R)-5-[(1R,2R,4aS,8aS)-2-hydroxy-2,5,5,8a-tetramethyl-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]-3-methylpentanoic acid	present	NPASS
(5alpha,11S,13beta,19alpha)-1,2-Didehydro-3beta-methoxycrinan-11-ol	present	LOTUS
11-Hydroxygalantamine	present	LOTUS
11-Hydroxyvittatine	present	LOTUS
2-(3,4-Dihydroxyphenyl)-5,7-dihydroxy-3-((6-O-beta-D-xylopyranosyl-beta-D-glucopyranosyl)oxy)-4H-1-benzopyran-4-one	present	NPASS
2-(3,4-dihydroxyphenyl)-5-hydroxy-3-[(2S,3R,4S,5R,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-7-[(2R,3R,4R,5R,6R)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxychromen-4-one	present	NPASS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hippeastrum papilio has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes4

GenBank sequences6

eDNA detections5

The DNA barcodea real sequence read deposited for this species

ITSAF223496.1 ↗645 bp

ACGT

TAGAGGCCCGAACGGACGATCGCGAACTCGTAGAGCAACCGTAGTGGGCGGTAGGGGGCGGCGATCGCCGTCTGCCTTCGCCTGCTTGGG …

Hippeastrum papilio internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hippeastrum papilio carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Flory, W. S. & R. F. Coulthard. 1981. New chromosome counts, numbers and types in genus Amaryllis. Pl. Life 37: 43–56.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type16 records

Wild obs. + sensor7

Museum / vouchered9

Origin

Native2

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 2>10 km 3

5 georeferenced · 2 without coordinates

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 8 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Porto Alegre, BR	2
Barcelona, ES	1
Irvine, US	1
UFSCarlocation not on record	1
Denver, US	1
Riverside, US	1
Saint Louis, US	1
Istituto Agrario Castelnuovolocation not on record	1

8 institutions · 9 of 9 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Hippeastrum papilio was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)