Hippeastrum morelianum

Lem. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Hippeastrum

At a glance

Occurrence records166

Data sources11

Biological traits14

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Hippeastrum morelianum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility166 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Chemical compositionNPASS6 compounds

Occurrence & distributionGBIF166 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB · GoaT13.1 Gbp

01Narrative

Hippeastrum morelianum is a species of plant of the family Amaryllidaceae found in the southwest of Brazil.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 500 m

Elevation min900 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTCampo Rupestre, Vegetação Sobre Afloramentos Rochosos

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition6 compounds

Compounds documented for Hippeastrum morelianum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Isoflavones3

Lupane triterpenoids1

Pterocarpan1

Documented compounds6 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Maackiain	present	NPASS
(8R)-3-(6-methoxy-1,3-benzodioxol-5-yl)-8-prop-1-en-2-yl-8,9-dihydrofuro[2,3-h]chromen-4-one	present	NPASS
Candimine	present	NPASS
Cuneatin methyl ether	present	NPASS
Fujikinetin methyl ether	present	NPASS
Lupeol	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hippeastrum morelianum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKC207435.1 ↗645 bpBrazil

ACGT

TAGAGGCCCGAACGGACGATCGCGAACTTGTAGAGCAACCGTAGTGGGCGGTAGGGGGCGGCGATCGCCGTCTGCCTTCGCCTGCTTGGG …

Hippeastrum morelianum voucher NA:Meerow 1304 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1★ITS2

fungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Hippeastrum morelianum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size13 149 210 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Hippeastrum morelianum13.15 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–242n range23median22mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 222×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Poggio L, González G, Naranjo CA. 2007. Chromosome studies in Hippeastrum (Amaryllidaceae): variation in genome size. Botanical Journal of the Linnean Society 155: 171-178.

2n 242×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Flory, W. S. 1980. A new basic chromosome number in Amaryllis (Amaryllidaceae) of suggestive evolutionary importance. ASB Bull. 27:33:00.

CCDB · ipcn-api-dl — Flory, W. S. & R. F. Coulthard. 1981. New chromosome counts, numbers and types in genus Amaryllis. Pl. Life 37: 43–56.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type166 records

Wild obs. + sensor93

Museum / vouchered73

Origin

Native51

Range

Area of Occupancy AOO520 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 93

93 georeferenced

Open the mapobservation + sensor93

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence73

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UFMGlocation not on record	31
JBRJlocation not on record	7
UNICAMPlocation not on record	6
Bronx, US	5
INMAlocation not on record	4
UFOPlocation not on record	3
Université de Bordeauxlocation not on record	2
UERJlocation not on record	2
UNESP-RClocation not on record	2
Universidade Federal de Juiz de Foralocation not on record	1
UnBlocation not on record	1
UNISANTAlocation not on record	1
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	1
Stockholm, SE	1
UFSJlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Santa Teresa, BR	1
FPMZBlocation not on record	1

18 institutions · 71 of 73 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Hippeastrum morelianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 25.1–25.1

Seasonal swing summer↔winter2.20 °C

Max temp (day)30.2 °C

Min temp (night)21.3 °C

Precipitation164 mm/mo

Air humidity64.0 %

Moisture balance32.9 mm/mo

Vapour deficit1,154 Pa

Wind speed1.10 m/s

Cloud cover45.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)