Hippeastrum aulicum

(Ker Gawl.) Herb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Hippeastrum

At a glance

Occurrence records221

Data sources13

Biological traits12

DNA specimens2

eDNA detections2

Sources13 archives

Databases and archives Hippeastrum aulicum's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility221 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Chemical compositionLOTUS · NPASS45 compounds

Occurrence & distributionGBIF221 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT16.2 Gbp

01Narrative

Hippeastrum aulicum, the Lily of the Palace, is a bulbous perennial, in the family Amaryllidaceae, native to the Atlantic Forest and Cerrado ecoregions from Brazil to Paraguay, in South America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formepiphyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTFloresta Ciliar ou Galeria, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Floresta Ombrófila Mista

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition45 compounds

Compounds documented for Hippeastrum aulicum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Abietane diterpenoids3

Pimarane and Isopimarane diterpenoids3

Menthane monoterpenoids $ Monocyclic monoterpenoids3

Labdane diterpenoids3

Norlabdane diterpenoids3

Documented compounds45 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-alpha-Pinene	present	NPASS
(+)-beta-Phellandrene	present	NPASS
(-)-alpha-Bisabolol	present	NPASS
(-)-beta-Pinene	present	NPASS
(-)-Sandaracopimaric acid	present	NPASS
(1S,13S,18S)-9-methoxy-5,7-dioxa-12-azapentacyclo[10.5.2.01,13.02,10.04,8]nonadeca-2,4(8),9,16-tetraen-18-ol	present	LOTUS
(2S)-pinocembrin	present	NPASS
(3S,8R,9R,10R,13R,14R,17R)-17-[(2R,5R)-5-ethyl-6-methylheptan-2-yl]-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthren-3-ol	present	NPASS
(E)-5-[(1R,4aS,8aS)-5,5,8a-trimethyl-2-methylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]-3-methylpent-2-enal	present	NPASS
(E)-5-[(1S,4aR,5S,8aR)-5-(3-carboxypropanoyloxymethyl)-5,8a-dimethyl-2-methylidene-3,4,4a,6,7,8-hexahydro-1H-naphthalen-1-yl]-3-methylpent-2-enoic acid	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hippeastrum aulicum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences3

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSJX464302.1 ↗724 bp

ACGT

ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTAGAGTCCCGAACGGACGATCGCGAACTCGTAGAGCAACCGTAGTGGGCGGT …

Hippeastrum aulicum internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Hippeastrum aulicum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size16 195 679 999 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Hippeastrum aulicum16.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidy2× diploid · measured

Chromosome records22–442n range22median22mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 2210×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-fedorov +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Arroyo, S. 1982. The chromosomes of Hippeastrum, Amaryllis and Phycella (Amaryllidaceae). Kew Bull. 37: 211–216.

CCDB · ipcn-api-dl — BRANDHAM, P. E. & P. S. Bhandol. 1997. Chromosomal relationships between the genera Amaryllis and Hippeastrum (Amaryllidaceae). Kew Bull. 52(4): 973–980.

CCDB · book-fedorov — Mookerjea 1955b

CCDB · book-fedorov — Traub 1958

CCDB · book-fedorov — Snoad 1952 (D. 1955)

CCDB · book-atlas-flowering-plants — Snoad 1952

CCDB · kew — Poggio L, González G, Naranjo CA. 2007. Chromosome studies in Hippeastrum (Amaryllidaceae): variation in genome size. Botanical Journal of the Linnean Society 155: 171-178.

CCDB · Cave1956supp — Mookerjea 1955a

2n 441×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Sveshnikova, L. I. & E. A. Zemskova. 1988. Chromosome numbers in some members of the Amaryllidaceae. Bot. Žhurn. (Moscow & Leningrad) 73: 1207–1208.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type221 records

Wild obs. + sensor56

Museum / vouchered162

Cultivated / captive1

Other2

Origin

Native54

Range

Area of Occupancy AOO504 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 25≤1 km 15≤10 km 4>10 km 2

46 georeferenced · 10 without coordinates

Open the mapobservation + sensor56

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 161 without coordinates

Open the institutions mapphysical evidence162

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blumenau, BR	36
San Jose State University, Museum of Birds and Mammalslocation not on record	22
INMAlocation not on record	12
Santa Teresa, BR	11
Laboratorio de Ictiologialocation not on record	7
Bronx, US	7
Kew, GB	7
JBRJlocation not on record	6
Feira de Santana, BR	5
Stockholm, SE	5
Universidade Federal de Juiz de Foralocation not on record	4
UFESlocation not on record	3
UFSCarlocation not on record	3
Salvador, BR	3
UFBAlocation not on record	3
Campo Mourão, BR	2
Saint Louis, US	2
University of Stellenboschlocation not on record	2
Federal University of Espírito Santolocation not on record	2
Porto Alegre, BR	2
UNICAMPlocation not on record	2
Ivano-Frankivsk, UA	1
UnBlocation not on record	1
Paris, FR	1
Universidade de São Paulolocation not on record	1
IAPlocation not on record	1
ESALQlocation not on record	1
Brasília, BR	1
UTFPR-CPlocation not on record	1
Museo naturalistico del Frignano Ferruccio Minghellilocation not on record	1
UNESP-RClocation not on record	1
South Kensington, GB	1

32 institutions · 157 of 162 vouchered records shown · 5 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Hippeastrum aulicum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)