Hintonia octomera

(Hemsl.) Bullock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Hintonia

At a glance

Occurrence records243

Data sources7

Biological traits11

DNA specimens5

eDNA detections3

Sources7 archives

Databases and archives Hintonia octomera's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF243 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Hintonia octomera là một loài thực vật có hoa trong họ Thiến thảo. Loài này được (Hemsl.) Bullock mô tả khoa học đầu tiên năm 1935.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction4

Dispersal typeself

Life formshrub or tree

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub

Woodinesswoody

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hintonia octomera has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences1

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKT333382.1 ↗656 bpMexico

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGACGAATCCTGCAAAGCAGACGACCGCGAACTCGTGCAACGCTCGGGCACCGGTGGACGTGCGG …

Hintonia octomera voucher Ochoterena-Booth 171 [MEXU] 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcLa★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type243 records

Wild obs. + sensor15

Museum / vouchered228

Range

Area of Occupancy AOO568 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 4≤1 km 3≤10 km 2

9 georeferenced · 6 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 169≤1 km 2≤10 km 10

181 georeferenced · 47 without coordinates

Open the institutions mapphysical evidence228

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durango, MX	63
Mérida, MX	60
Mexico City, MX	48
Tapachula, MX	17
Saint Louis, US	12
San Francisco de Campeche, MX	11
Chicago, US	8
Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record	2
Riverside, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Canadian Department of Agriculturelocation not on record	1
ASUlocation not on record	1

12 institutions · 225 of 228 vouchered records shown · 3 without an institution code

09Environmental DNA3 detections

Where the DNA of Hintonia octomera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 22.9–28.1

Seasonal swing summer↔winter5.40 °C

Max temp (day)30.8 °C 27.8–33.7

Min temp (night)21.4 °C 19.0–23.7

Precipitation114 mm/mo 69.8–157

Air humidity61.3 % 59.7–62.8

Moisture balance-16.8 mm/mo -31.0–-2.60

Vapour deficit1,295 Pa 1,048–1,542

Wind speed1.50 m/s 1.40–1.70

Cloud cover29.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)