Hildenbrandia rivularis

(Liebman) J.Agardh · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Hildenbrandiales/Hildenbrandiaceae/Hildenbrandia

At a glance

Occurrence records2 650

Data sources6

Biological traits1

DNA specimens14

eDNA detections97

Sources6 archives

Databases and archives Hildenbrandia rivularis's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 650 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI97 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF2 650 records

Environmental DNA3 datasets · 2 countries97 detections

DNA & barcodingBOLD · NCBI14 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat freshwateryes

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hildenbrandia rivularis has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes1

GenBank sequences9

eDNA detections97

Countries7

The DNA barcodea real sequence read deposited for this species

rbcLAF208813.1 ↗1 010 bpUnited Kingdom

ACGT

TCTAACGATCAATATTTTGCTTATATATCATATGATATTGACCTATTTGAAGAAGGATCGATAGCCAACTTGACTGCTTCCATTATCGGT …

Hildenbrandia rivularis Wales 2 rbcL gene, partial cds; chloroplast gene for chloroplast product

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL9

plant barcode

08Occurrence & distribution

Record type2 650 records

Wild obs. + sensor2 326

Museum / vouchered201

Other123

Range

Area of Occupancy AOO5 352 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 1 719≤1 km 38≤10 km 535>10 km 9

2 301 georeferenced · 25 without coordinates

Open the mapobservation + sensor2 326

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 6≤1 km 11≤10 km 24>10 km 6

47 georeferenced · 154 without coordinates

Open the institutions mapphysical evidence201

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Frankfurt am Main	26
LDlocation not on record	16
Bronx, US	12
Brisbane, AU	8
Museo Entomologico de Leonlocation not on record	6
Uppsala, SE	6
Provincia di Livornolocation not on record	4
Ann Arbor, US	4
South Kensington, GB	4
Clocation not on record	2
McWane Science Centerlocation not on record	2
Christchurch, NZ	2
PHlocation not on record	2
Minia, EG	2
Durham, US	1
BISHlocation not on record	1
DASSHlocation not on record	1
Uniwersytet Wrocławskilocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Honolulu, US	1

20 institutions · 102 of 201 vouchered records shown · 99 without an institution code

09Environmental DNA97 detections

Where the DNA of Hildenbrandia rivularis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found97

Studies independent surveys3

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 97 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature20.0 °C 16.9–24.5

pH8.18 7.38–8.59

Conductivity48,350 µS/cm 43,600–53,500

Salinity34.3 PSU 32.1–38.6

Nitrate0.621 µmol/L 0.157–3.07

Depth2.00 m 2.00–3.00

SedimentCoastal water

83 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 13.2–21.0

Seasonal swing summer↔winter8.10 °C

Max temp (day)18.7 °C 15.6–22.7

Min temp (night)15.4 °C 10.7–19.2

Precipitation108 mm/mo 79.9–126

Air humidity58.5 % 56.6–61.5

Moisture balance2.50 mm/mo -74.0–49.7

Vapour deficit808 Pa 649–953

Wind speed5.80 m/s 2.30–6.10

Cloud cover24.0 % 20.6–26.3

CHELSA 1981–2010, ~9 km grid, at location & month of 84 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hildenbrandia rivularis

At a glance

Sources6 archives

Habitat & environment1

At a glance

Record type2 650 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 20 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type2 650 records