Hieracium vulgatum

Spreng. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Hieracium

At a glance

Occurrence records5 727

Data sources6

Biological traits10

DNA specimens20

eDNA detections8

Sources6 archives

Databases and archives Hieracium vulgatum's data was compiled from.

GBIFGlobal Biodiversity Information Facility5 727 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources10 traits

Occurrence & distributionGBIF5 727 records

Environmental DNA1 datasets · 3 countries8 detections

DNA & barcodingBOLD · NCBI20 specimens

02Traits & measurements

SourcesLEDA

Size & morphology3

Leaf mass70.75 mg

Leaf size3 674 mm²

Seed mass0.352 mg

Life cycle & reproduction3

Dispersal typeanimal

Life spanpoly-annuals 5-50 years (medium-lived perennials)

Seed number533

Habitat & environment1

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)95.01 mg/g

Seed longevity index0

Specific leaf area (SLA)57.91 mm²/mg

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hieracium vulgatum has left across the world's sequence archives.

At a glance

DNA specimens20

Marker genes5

GenBank sequences2

eDNA detections8

Countries3

The DNA barcodea real sequence read deposited for this species

rbcLMG222451.1 ↗552 bpCanada · 1969

ACGT

AGTGTTGGATTCAAAGCTGGTGTTAAAGATTATAAATTGACTTATTATACTCCTGACTATCAAACCAAGGATACTGATATTTTGGCAGCA …

Hieracium lachenalii subsp. cruentifolium voucher 81032HIM ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL2★rbcLa★ITS★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type5 727 records

Wild obs. + sensor4 114

Museum / vouchered1 596

Cultivated / captive17

Range

Area of Occupancy AOO10 748 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy36% within 1 km

≤100 m 173≤1 km 1 228≤10 km 2 478>10 km 6

3 885 georeferenced · 229 without coordinates

Open the mapobservation + sensor4 114

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 613≤1 km 65≤10 km 270>10 km 564

1 512 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence1 596

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 16

16 georeferenced · 1 without coordinates

Open the mapnot free-living17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uppsala, SE	518
DBF-NHMDlocation not on record	512
Olocation not on record	394
BFLlocation not on record	29
KMNlocation not on record	24
BClocation not on record	14
Trondheim, NO	14
TROMlocation not on record	13
Kandalaksha State Nature Reservelocation not on record	11
Vancouver, CA	9
Mlocation not on record	7
Bergen, NO	5
University of Guelph, OAC Herbariumlocation not on record	3
Tilburg, NL	3
Zürich, CH	2
Research Collection of B. A. Bennettlocation not on record	2
Provincia di Livornolocation not on record	2
Jyväskylä, FI	2
Moscow State Universitylocation not on record	2
Naturalis Biodiversity Centerlocation not on record	1
Görlitz, DE	1
National Museum Waleslocation not on record	1
Christchurch, NZ	1
Wlocation not on record	1
Xiamen, CN	1

25 institutions · 1 572 of 1 596 vouchered records shown · 24 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA8 detections

Where the DNA of Hieracium vulgatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 6.80–19.6

Seasonal swing summer↔winter26.3 °C

Max temp (day)20.1 °C 9.60–24.6

Min temp (night)13.1 °C 2.90–15.7

Precipitation94.5 mm/mo 56.1–118

Air humidity61.0 % 59.2–65.5

Moisture balance-21.1 mm/mo -64.2–18.9

Vapour deficit735 Pa 336–933

Wind speed3.50 m/s 2.10–5.10

Cloud cover46.3 % 38.9–57.8

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hieracium vulgatum

At a glance

Sources6 archives

Size & morphology3

Life cycle & reproduction3

Habitat & environment1

Physiology & chemistry3

At a glance

Record type5 727 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions10 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 727 records