Hieracium virosum

Pall. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Hieracium

At a glance

Occurrence records2 979

Data sources9

Biological traits25

DNA specimens3

eDNA detections1

Sources9 archives

Databases and archives Hieracium virosum's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 979 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Occurrence & distributionGBIF2 979 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB6.4 Gbp

01Narrative

Нечуйвітер отруйний — вид рослин з родини айстрових (Asteraceae), поширений у Європі й помірній Азії.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology10

Fruit length3 mm

Fruit length max3 mm

Fruit length min3 mm

Leaf length65 mm

Leaf length max80 mm

Leaf length min50 mm

Plant height0.6 m

Plant height max1.2 m

Plant height min0.3 m

Seed mass0.743 mg

Life cycle & reproduction5

Flowering endSep

Flowering startJul

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 100 m

Elevation mean3 200 m

Elevation min2 700 m

Growth formherb

Habitat GIFTforest, meadows, steppe, stony places

Mycorrhiza typearbuscular

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hieracium virosum has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes4

GenBank sequences9

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH808134.1 ↗649 bpChina

ACGT

TTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACTTGTACCAACAACTGGGAGACGGGGAGACGACCTTGGTCTCGACCCCGCCACCCT …

Hieracium virosum voucher Huangxw1696 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL3★rbcLa★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hieracium virosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size6 386 340 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Hieracium virosum6.39 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidy3× triploid · measured

Chromosome records18–362n range36median36mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 275×CCDB · hieracium · CCDB · ipcn-api-dl · CCDB · kew

CCDB · hieracium — Belaeva & Siplivinsky 1976; Volkova & Boyko 1986

CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1976. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 61(6): 873–880.

CCDB · ipcn-api-dl — Krasnikov, A. A., O. S. Zhirova, M. N. Lomonosova & S. V. Smirnov. 2003. Chromosome numbers of Asteraceae from the southern Siberia and Kazakhstan. Bot. Žhurn. (Moscow & Leningrad) 88(9): 151–153.

CCDB · ipcn-api-dl — Krasnikov. 2004. Chromosome numbers of some species of Hieracium and Pilosella (Asteraceae) from Siberia. Bot. Žhurn. (Moscow & Leningrad) 89(1): 132–133.

CCDB · kew — Chrtek J, Jr, Zahradnicek J, Krak K, Fehrer J. 2009. Genome size in Hieracium subgenus Hieracium (Asteraceae) is strongly correlated with major phylogenetic groups. Annals of Botany 104: 161-178.

2n 365×CCDB · iapt · CCDB · hieracium · CCDB · ipcn-api-dl +1

CCDB · iapt

CCDB · hieracium — Rosenberg 1926c; Christoff & Popoff 1933; Gentcheff & Gustafsson 1940b; Astanova et al. 1989

CCDB · ipcn-api-dl — Astanova, S. B. 1989. Khromosomnye chisla predstavitelej slozhnocvetnykh flory Tadzhikistana. Pp. 89--90 in Tesizy II Symp. Plant Karyology.

CCDB · book-indian_vol1 — Rosenberg, O. 1926

2n 181×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Nazarova. 2004. Pages 1--171 in Chromosome Numbers of Flowering Plants of Armenian Flora. Yerevan.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

triploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 979 records

Wild obs. + sensor2 573

Museum / vouchered381

Other25

Origin

Native2

Range

Area of Occupancy AOO5 524 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy41% within 1 km

≤100 m 668≤1 km 199≤10 km 945>10 km 319

2 131 georeferenced · 442 without coordinates

Open the mapobservation + sensor2 573

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 25≤1 km 31≤10 km 96>10 km 58

210 georeferenced · 171 without coordinates

Open the institutions mapphysical evidence381

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	157
GMBAlocation not on record	90
Urumqi, CN	15
BRNUlocation not on record	14
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	13
IWEP FEB RASlocation not on record	7
Beijing, CN	3
South Kensington, GB	3
Institute of Applied Ecology, Academia Sinicalocation not on record	2
Görlitz, DE	2
Samara National Research Universitylocation not on record	2
Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record	2
Frankfurt am Main	2
Bronx, US	1
GJOlocation not on record	1
Berlin, DE	1
Jiangxi College of Educationlocation not on record	1
Uniwersytet Opolskilocation not on record	1
València, ES	1
Wlocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	1

23 institutions · 322 of 381 vouchered records shown · 59 without an institution code

09Environmental DNA1 detections

Where the DNA of Hieracium virosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.4 °C 21.4–21.4

Seasonal swing summer↔winter33.6 °C

Max temp (day)25.9 °C

Min temp (night)16.4 °C

Precipitation38.7 mm/mo

Air humidity49.2 %

Moisture balance-106 mm/mo

Vapour deficit1,295 Pa

Wind speed2.90 m/s

Cloud cover34.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hieracium virosum

At a glance

Sources9 archives

Size & morphology10

Life cycle & reproduction5

Habitat & environment10

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type2 979 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 979 records