Hieracium sabaudum
speciesAt a glance
Occurrence records50 792
Data sources11
Biological traits51
DNA specimens22
eDNA detections11
Sources11 archives
Databases and archives Hieracium sabaudum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility50 792 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics22 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources51 traits
Occurrence & distributionGBIF50 792 records
Environmental DNA1 datasets · 3 countries11 detections
DNA & barcodingBOLD · NCBI22 specimens
Genome at a glanceCCDB5.7 Gbp
01Narrative
L'Épervière de Savoie est une espèce de plante à fleurs du genre des Épervières et de la famille des Astéracées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology21
Fruit length4 mm
Fruit width1 mm
Leaf length max75 mm
Leaf mass37.09 mg
Leaf size1 637 mm²
Leaf width28 mm
Leaf width max28 mm
Leaf width min28 mm
Plant height0.7 m
⚠ sources differ — GIFT: 0.7 m · LEDA: 0.8 m · TRY: 0.05 m
Plant height generative1 m
Plant height max1.2 m
Plant height min0.3 m
Seed length2.75 mm
⚠ sources differ — TRY: 2.75 mm · GIFT: 3.5 mm
Seed length max3.5 mm
Seed length min3.5 mm
Seed mass0.467 mg
⚠ sources differ — TRY: 0.467 mg · LEDA: 0.47 mg · GIFT: 0.445 mg
Seed mass max0.49 mg
Seed mass min0.38 mg
Seed width0.5 mm
Seed width max0.5 mm
Seed width min0.5 mm
Life cycle & reproduction14
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: anemochorous
Flowering endOct
Flowering startAug
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualpresent
Seed number99 292
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment7
Aquaticterrestrial
Climberself-supporting
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTforest edges
Woodinessnon-woody
Physiology & chemistry6
Leaf C:N ratio26.49 g/g
Leaf c465 mg/g
Leaf dry-matter content (LDMC)163 mg/g
⚠ sources differ — TRY: 163 mg/g · LEDA: 112 mg/g
Leaf n18.36 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)37.51 mm²/mg
⚠ sources differ — TRY: 37.51 mm²/mg · LEDA: 45.57 mm²/mg · GIFT: 45.57 mm²/mg
Other traits1
Diaspore typefruit
05DNA & barcoding22 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hieracium sabaudum has left across the world's sequence archives.
At a glance
DNA specimens22
Marker genes5
GenBank sequences4
eDNA detections11
Countries3
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATC …
Hieracium sabaudum voucher 35652HIM 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL2★rbcLa★ITS2★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Hieracium sabaudum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size5 740 371 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Hieracium sabaudum5.74 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy3× triploid · measured
Chromosome records18–362n range18median18mode15records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2740×CCDB · ita-fl · CCDB · slov-fl · CCDB · iber-fl +8
CCDB · ita-fl — SELVI F., FIORINI G. - 1997 (1996). Karyology of Hieracium L. subg. Hieracium (Asteraceae) from Mount Amiata (Central Italy).. Caryologia , 49(3-4): 287-299.
CCDB · ita-fl — AVANCINI F., D'AMATO G., LUCCHESE F., MATTEUCCI M. - 2005. Ricerche sistematiche nella flora del territorio Tolfetano-Cerite (Lazio). Inform. Bot. Ital. , 37(1A): 304-305.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Chrtek J. jun., Mráz P. & Severa M., 2004: Chromosome numbers in selected species of Hieracium s. str. (Hieracium subgen. Hieracium) in the Western Carpathians. - Preslia 76/2: 119-139.
CCDB · iber-fl — Contribuiao para o conhecimento citotaxonmico das spermatophyta de Portugal. II. Compositae, supl. 1 Queirs, M.Bol. Soc. Brot. ser. 247: 299-314(1973).
CCDB · hieracium — Rosenberg 1917; Rosenberg 1926c; Christoff & Popoff 1933; M?jovsk? et al. 1970; Queir?s 1973; Morton 1974 (2 counts as H. perpropinquum (Zahn) Druce); Mes?cek & Jarol?mov? 1992
CCDB · hieracium — Queiros 1973
CCDB · hieracium — M?jovsky et al. 1974; Morton 1974
CCDB · hieracium — Morton 1974
CCDB · poland — Szel?g Z., Vladimirov V. 2005. Chromosome numbers of Polish Hieracia (Asteraceae). Polish Botanical Journal 50, 139-143.
CCDB · ipcn-api-dl — Kirschner, J. & J. `tĕpánek. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Chrtek. 2004. Chromosome numbers in selected species of Hieracium s. str. (Hieracium subgen. Hieracium) in the western Carpathians. Preslia 76(2): 119–139.
CCDB · ipcn-api-dl — Schuhwerk, F. & W. Lippert. 1999. Chromosomenzahlen von Hieracium (Compositae, Lactuceae) Teil 3. Sendtnera 6: 197–214.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · book-ipcn73-74 — MORTON, J.K. 1974. Chromosome numbers of British plants, 3. Watsonia 10: 169.
CCDB · book-ipcn73-74 — QUEIROS, M. 1973. Contribuicao para o conhecimento citotaxonomico dJ spermatophyta de Portugal. 47(Ser. 2l: 299-314. II Compositae, supl. I Bol. Soc. Brot. I
CCDB · book-fedorov — Rosenberg 1926c
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — Murin, Vachova
CCDB · book-fedorov — I. Slov. fl. I. 1967)
CCDB · book-fedorov — Christoff. Popoff 1933
CCDB · book-fedorov — Uhrikova, Murin
CCDB · kew — Chrtek J, Jr, Zahradnicek J, Krak K, Fehrer J. 2009. Genome size in Hieracium subgenus Hieracium (Asteraceae) is strongly correlated with major phylogenetic groups. Annals of Botany 104: 161-178.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Queirós, M. (1973b). Contribuiçao para o conhecimento citotaxonómico das Spermatophyta de Portugal. II. Compositae, supl. 1. Bol. Soc. Brot. 47: 299-314.
2n 1811×CCDB · slov-fl · CCDB · hieracium · CCDB · ipcn-api-dl +3
CCDB · slov-fl — Hrušovská-Osuská Ľ., 1988: Karyological study of some taxa of the flora of the northern part of Považský Inovec. Part I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 35: 69-79.
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Uhríková A. & Feráková V., 1977: [Report], pp. 263. - In: Löve Á. (ed.), IOPB Chromosome number reports LVI, Taxon 26 /2-3.
CCDB · slov-fl — Feráková V., 1971b: Chromosome numbers in some species of the Cichoriese [Cichorieae] from Slovakia. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 19: 249-255.
CCDB · hieracium — Chouksanova et al. 1968; Uhr?kov? & Ferakova 1977
CCDB · hieracium — M?jovsky et al. 1974
CCDB · ipcn-api-dl — Uhrikova, A. & V. Ferakova. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.
CCDB · ipcn-api-dl — Hruaovská-Osuská, L. 1988. Karyological study of some taxa of the flora of the northern part of Povăzsk@3y Inovec. Part I. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 35: 69–79.
CCDB · book-ipcn67-71 — CHOUKSANOVA, N.A., L.I. SVESHNIKOVA, & T.V. ALEXANDROVA. 1968. Data on karyology of the family Compositae Giseke. Citologija 10: 198-206.
CCDB · book-fedorov — MYKCanoBa HAP
CCDB · CromoCat 2015 — Uhríková, A. & V. Feráková. (1977). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LVI]. Taxon 26(2/3): 263.
2n 364×CCDB · hieracium · CCDB · poland · CCDB · ipcn-api-dl +1
CCDB · hieracium — Rosenberg 1926
CCDB · poland — Szel?g Z., Vladimirov V. 2005. Chromosome numbers of Polish Hieracia (Asteraceae). Polish Botanical Journal 50, 139-143.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · CromoCat 2015 — Albers, F. & Pröbsting, W. (1998). In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
triploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type50 792 records
Wild obs. + sensor44 124
Museum / vouchered5 492
Cultivated / captive15
Other1 161
Origin
Native2 020
Range
Area of Occupancy AOO99 816 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy29% within 1 km
≤100 m 3 365≤1 km 6 184≤10 km 22 844>10 km 169
32 562 georeferenced · 11 562 without coordinates
Open the mapobservation + sensor44 124
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 383≤1 km 865≤10 km 1 875>10 km 56
3 179 georeferenced · 2 313 without coordinates
Open the institutions mapphysical evidence5 492
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 11
11 georeferenced · 4 without coordinates
Open the mapnot free-living15
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions51 of 120 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 875 |
| BRNUlocation not on record | 642 |
| Mlocation not on record | 245 |
| BFLlocation not on record | 232 |
| BIO-UNIPIlocation not on record | 216 |
| Provincia di Livornolocation not on record | 190 |
| Görlitz, DE | 175 |
| MeiseBGlocation not on record | 158 |
| Adam Mickiewicz University in Poznańlocation not on record | 132 |
| Salzburg, AT | 100 |
| València, ES | 98 |
| PRClocation not on record | 84 |
| BDBClocation not on record | 76 |
| South Kensington, GB | 62 |
| PrivatHerblocation not on record | 53 |
| Berlin, DE | 45 |
| Allentown, US | 45 |
| Bern, CH | 44 |
| GJOlocation not on record | 44 |
| BSBIlocation not on record | 39 |
| Wlocation not on record | 39 |
| GZUlocation not on record | 30 |
| Uniwersytet Warszawskilocation not on record | 30 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 27 |
| MAlocation not on record | 25 |
| BClocation not on record | 24 |
| Entomological Society of Latvialocation not on record | 24 |
| WTUlocation not on record | 24 |
| H-Schuhwlocation not on record | 23 |
| Uniwersytet Śląski w Katowicachlocation not on record | 19 |
| H-Meierottlocation not on record | 19 |
| University of Bayreuthlocation not on record | 18 |
| Barcelona, ES | 18 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 18 |
| Uppsala, SE | 17 |
| Frankfurt am Main | 17 |
| LDlocation not on record | 16 |
| Vancouver, CA | 15 |
| Nijmegen, NL | 15 |
| Karlsruhe, DE | 14 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 14 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 14 |
| Olocation not on record | 13 |
| sonstHerblocation not on record | 12 |
| SZUlocation not on record | 11 |
| Moscow, US | 11 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 10 |
| Philadelphia, US | 9 |
| H-Dueringlocation not on record | 9 |
| Zürich, CH | 8 |
| Podgorica, ME | 7 |
| Chongqing Museumlocation not on record | 7 |
| CJBGlocation not on record | 7 |
| John May Museum of Natural Historylocation not on record | 7 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Namur, BE | 6 |
| Fulda, DE | 5 |
| New Brunswick, US | 5 |
| LfUlocation not on record | 5 |
| Christchurch, NZ | 4 |
| Salamanca, ES | 4 |
| Museo Achille Folettolocation not on record | 4 |
| Corvallis, US | 4 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| IDElocation not on record | 4 |
| Portland, US | 3 |
| München, DE | 3 |
| Sant Julià de Lòria, AD | 3 |
| Madrid, ES | 3 |
| New Haven, US | 3 |
| H-Gottschllocation not on record | 3 |
| Pullman, US | 3 |
| IBFlocation not on record | 3 |
| Madrid, ES | 3 |
| BGBMlocation not on record | 3 |
| Bourges, FR | 3 |
| Alicante, ES | 3 |
| Museo Jorge Gerholdlocation not on record | 2 |
| University of New Hampshirelocation not on record | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| San Sebastián, ES | 2 |
| H-Hohlalocation not on record | 2 |
| FLADlocation not on record | 2 |
| Vitoria, ES | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Musée des Confluenceslocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Québec, CA | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Museum für Naturkundelocation not on record | 1 |
| H-Adlerlocation not on record | 1 |
| Sion, CH | 1 |
| Riverside, US | 1 |
| Wayland Universitylocation not on record | 1 |
| Dresden, DE | 1 |
| Toronto, CA | 1 |
| Bangkok, TH | 1 |
| Saint John, CA | 1 |
| NoColllocation not on record | 1 |
| Guangzhou, CN | 1 |
| Mississippi State, US | 1 |
| National Museum Waleslocation not on record | 1 |
| Technische Universität Münchenlocation not on record | 1 |
| Brussel, BE | 1 |
| NWLAlocation not on record | 1 |
| STUlocation not on record | 1 |
| Tilburg, NL | 1 |
| Hobart, AU | 1 |
| M-VascularPlantslocation not on record | 1 |
| Universität Tübingenlocation not on record | 1 |
| H-Dunkellocation not on record | 1 |
| Bloomington, US | 1 |
| CJBNlocation not on record | 1 |
| Saint Louis, US | 1 |
| Pittsburg, US | 1 |
| KMNlocation not on record | 1 |
| Burlington, US | 1 |
| Sevilla, ES | 1 |
120 institutions · 5 278 of 5 492 vouchered records shown · 103 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA11 detections
Where the DNA of Hieracium sabaudum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map3 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.2 °C 5.50–17.8
Seasonal swing summer↔winter15.5 °C
Max temp (day)18.7 °C 7.60–21.9
Min temp (night)13.2 °C 2.80–16.0
Precipitation76.9 mm/mo 72.3–83.7
Air humidity61.9 % 60.1–64.6
Moisture balance-33.2 mm/mo -71.5–36.4
Vapour deficit695 Pa 320–810
Wind speed4.60 m/s 2.90–5.30
Cloud cover37.6 % 35.3–48.6
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.