Hieracium prenanthoides

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Hieracium

At a glance

Occurrence records727

Data sources6

Biological traits33

DNA specimens9

eDNA detections4

Sources6 archives

Databases and archives Hieracium prenanthoides's data was compiled from.

GBIFGlobal Biodiversity Information Facility727 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources33 traits

Occurrence & distributionGBIF727 records

Environmental DNA1 datasets · 3 countries4 detections

DNA & barcodingBOLD · NCBI9 specimens

Genome at a glanceGoaT4.9 Gbp

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology7

Leaf size939 mm²

Plant height0.575 m

⚠ sources differ — GIFT: 0.575 m · LEDA: 0.575 m · TRY: 0.815 m

Plant height generative0.618 m

Plant height max1.4 m

Plant height min0.2 m

Seed length3.9 mm

Seed mass0.777 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typewind

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Seed number450

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 800 m

Elevation min500 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, forest edges, mountains, shrubberies

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry6

Leaf c455 mg/g

Leaf dry-matter content (LDMC)216 mg/g

Leaf n25.67 mg/g

Leaf p2.5 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)21.95 mm²/mg

Other traits1

Diaspore typefruit

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hieracium prenanthoides has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes6

GenBank sequences8

eDNA detections4

Countries3

The DNA barcodea real sequence read deposited for this species

ITSAJ633417.1 ↗637 bpAustria

ACGT

TCGAACCCTGCAAAGCAGAACGACCCGTGAACTTGTACCAACAACTGGGAGACGGGGAGACTGACATTGGTCTCGATCCCCGCCACCCTC …

Hieracium prenanthoides 5.8S rRNA gene, ITS1 and ITS2, specimen voucher GAT-bg262

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL★rbcLa★ITS7★ITS1★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Hieracium prenanthoides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 914 450 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Hieracium prenanthoides4.91 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidy2× / 3× cytotypes

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 272×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

2n 181×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

08Occurrence & distribution

Record type727 records

Wild obs. + sensor192

Museum / vouchered347

Other188

Range

Area of Occupancy AOO1 420 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 56≤1 km 21≤10 km 18>10 km 2

97 georeferenced · 95 without coordinates

Open the mapobservation + sensor192

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 51≤1 km 53≤10 km 39>10 km 117

260 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence347

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uppsala, SE	110
Olocation not on record	77
LDlocation not on record	46
Moscow State Universitylocation not on record	31
TROMlocation not on record	22
Görlitz, DE	15
Trondheim, NO	7
KMNlocation not on record	7
BClocation not on record	6
Bern, CH	2
Mlocation not on record	1
National Museum Waleslocation not on record	1
Sion, CH	1
Provincia di Livornolocation not on record	1
Tromso University Museumlocation not on record	1
Göteborg, SE	1

16 institutions · 329 of 347 vouchered records shown · 16 without an institution code

09Environmental DNA4 detections

Where the DNA of Hieracium prenanthoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.10 °C 7.00–11.6

Seasonal swing summer↔winter19.8 °C

Max temp (day)11.2 °C 10.7–13.8

Min temp (night)3.40 °C 2.10–7.50

Precipitation164 mm/mo 130–170

Air humidity64.4 % 64.0–66.4

Moisture balance100 mm/mo 40.1–117

Vapour deficit405 Pa 403–461

Wind speed2.60 m/s 2.50–4.30

Cloud cover50.4 % 44.9–60.9

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)