Hieracium piloselloides

Wallr., 1822 · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Hieracium

At a glance

Occurrence records684

Data sources3

Biological traits20

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Hieracium piloselloides's data was compiled from.

GBIFGlobal Biodiversity Information Facility684 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources20 traits

Occurrence & distributionGBIF684 records

DNA & barcodingNCBIsequences

Genome at a glanceNCBI≈3.3 Gbp

02Traits & measurements

SourcesGIFTLEDA

Size & morphology6

Leaf mass1.09 mg

Leaf size556 mm²

Plant height0.11 m

Plant height max0.6 m

Plant height min0.3 m

Seed mass0.124 mg

⚠ sources differ — LEDA: 0.124 mg · GIFT: 0.422 mg

Life cycle & reproduction5

Dispersal typewater

Flowering endAug

Flowering startJun

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)208 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)26.79 mm²/mg

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hieracium piloselloides has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG219793.1 ↗296 bpCanada · 1972

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATC …

Pilosella piloselloides voucher CCDB-22992-B12 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS7

plant barcodefungal barcode

06Genome at a glanceNCBI

The complete instruction manual Hieracium piloselloides carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈3 325 137 093 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Hieracium piloselloides3.33 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type684 records

Wild obs. + sensor537

Museum / vouchered147

Origin

Introduced35

Range

Area of Occupancy AOO1 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 70≤1 km 364≤10 km 48

482 georeferenced · 55 without coordinates

Open the mapobservation + sensor537

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 5≤1 km 22≤10 km 101>10 km 1

129 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence147

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	90
Uniwersytet Śląski w Katowicachlocation not on record	17
Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record	9
Vancouver, CA	8
Uniwersytet Warszawskilocation not on record	8
Wuzhou, CN	4
McWane Science Centerlocation not on record	3
EL PASO, US	1
Meguro Parasitological Museumlocation not on record	1
Emporia, US	1
Philadelphia, US	1
WTUlocation not on record	1
SZUlocation not on record	1
València, ES	1

14 institutions · 146 of 147 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)