Hieracium murorum
speciesAt a glance
Occurrence records150 924
Data sources10
Biological traits58
DNA specimens33
eDNA detections16
Sources10 archives
Databases and archives Hieracium murorum's data was compiled from.
GBIFGlobal Biodiversity Information Facility150 924 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics33 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements5 literature sources58 traits
Occurrence & distributionGBIF150 924 records
Environmental DNA1 datasets · 5 countries16 detections
DNA & barcodingBOLD · NCBI33 specimens
Genome at a glanceCCDB4.9 Gbp
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology23
Fruit length3 mm
Leaf length80 mm
Leaf length max110 mm
Leaf length min50 mm
Leaf mass102 mg
Leaf size181 mm²
⚠ sources differ — TRY: 181 mm² · LEDA: 4 069 mm² · GIFT: 4 069 mm²
Leaf width35 mm
Leaf width max45 mm
Leaf width min25 mm
Petiole length4 cm
Plant height0.242 m
⚠ sources differ — GIFT: 0.242 m · AusTraits: 0.7 m · LEDA: 0.135 m · TRY: 0.03 m
Plant height generative0.153 m
Plant height max0.8 m
Plant height min0.15 m
Seed length3.25 mm
⚠ sources differ — TRY: 3.25 mm · GIFT: 3 mm
Seed length max3 mm
Seed length min3 mm
Seed mass0.406 mg
⚠ sources differ — TRY: 0.406 mg · LEDA: 0.4 mg · GIFT: 0.378 mg
Seed mass max0.41 mg
Seed mass min0.32 mg
Seed width0.5 mm
Seed width max0.5 mm
Seed width min0.5 mm
Life cycle & reproduction14
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: anemochorous
Flowering endJul
Flowering startMay
Life formperennial
Life spanperennial
Lifespan years4.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number59 587
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climberself-supporting
Elevation max2 460 m
Elevation min0 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTforest
Leaf shapeelliptical
Mycorrhiza typearbuscular
Woodinessnon-woody
⚠ sources differ — TRY: non-woody · AusTraits: herbaceous woody_root · LEDA: non-woody · GIFT: non-woody
Physiology & chemistry7
Leaf C:N ratio16.57 g/g
Leaf c463 mg/g
Leaf dry-matter content (LDMC)152 mg/g
⚠ sources differ — TRY: 152 mg/g · LEDA: 124 mg/g
Leaf n28.17 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Specific leaf area (SLA)38.8 mm²/mg
Other traits1
Diaspore typefruit with appendage
05DNA & barcoding33 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hieracium murorum has left across the world's sequence archives.
At a glance
DNA specimens33
Marker genes6
GenBank sequences5
eDNA detections16
Countries5
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATC …
Hieracium murorum voucher CCDB-18323-C6 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL3★rbcLa★ITS2★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Hieracium murorum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size4 876 327 959 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Hieracium murorum4.88 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 36 n = 18
Ploidy3× triploid · measured
Chromosome records36–362n range36median36mode7records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2732×CCDB · ita-fl · CCDB · slov-fl · CCDB · iapt +6
CCDB · ita-fl — SELVI F., FIORINI G. - 1997 (1996). Karyology of Hieracium L. subg. Hieracium (Asteraceae) from Mount Amiata (Central Italy).. Caryologia , 49(3-4): 287-299.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · slov-fl — Chrtek J. jun., Mráz P. & Severa M., 2004: Chromosome numbers in selected species of Hieracium s. str. (Hieracium subgen. Hieracium) in the Western Carpathians. - Preslia 76/2: 119-139.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · hieracium — Christoff & Popoff 1933; Gustafson 1933; Gentcheff 1937a; M?jovsk? et al. 1970; Dmitrieva et al. 1977; Finch ined. in D.M. Moore 1982; Strid & Anderson 1985; Dmitrieva 1987; Lavrenko & Serditov 1987; Lavrenko et al. 1988; Lavrenko et al. 1989 (as "aggr."); Lavrenko et al. 1990
CCDB · hieracium — Finch ined. in D.M. Moore 1982
CCDB · mediterranean
CCDB · ipcn-api-dl — Strid, A. & I. A. Andersson. 1985. Chromosome numbers of Greek mountain plants. An annotated list of 115 species. Bot. Jahrb. Syst. 107: 203–228.
CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1987. Chromosome numbers in some members of the Urals flora (the Komi Autonomous Soviet Socialist Republic). Bot. Zhurn. SSSR 72: 846–847.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1987. Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23–33.
CCDB · ipcn-api-dl — Lavrenko, A. N., N. P. Serditov & Z. G. Ulle. 1990. Chromosome numbers in some species of flowering plants of the Urals (the Komi Autonomous Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 75: 1622–1624.
CCDB · ipcn-api-dl — Albers, F. & W. Pröbsting. 1998. In R. Wisskirchen & H. Haeupler, Standardliste der Farn- und Blütenpflanzen Deutschlands. Bundesamt für Naturschutz & Verlag Eugen Ulmer, Stuttgart.
CCDB · ipcn-api-dl — Dmitrieva, S. A., V. I. Parfenov & I. V. SCHVEC. 1977. The karyological characterization of some species of the Belorussian flora. Vesci Akad. Navuk Belarusk SSR Ser. Bi jal. Sel'skagasp. Navuk. 19: 82–91.
CCDB · ipcn-api-dl — Chrtek. 2004. Chromosome numbers in selected species of Hieracium s. str. (Hieracium subgen. Hieracium) in the western Carpathians. Preslia 76(2): 119–139.
CCDB · ipcn-api-dl — Finch. 1982. In D.M. Moore, Flora Europaea Check-list and Chromosome Index. Cambridge Univ. Press. Pp. 283–286.
CCDB · book-fedorov — Gustafsson 1933a
CCDB · book-fedorov — Tischler 1934
CCDB · book-fedorov — Gentscheff 1937a, 1938
CCDB · book-fedorov — Rohweder 1937
CCDB · kew — Temsch EM, Temsch W, Ehrendorfer-Schratt L, Greilhuber J. 2010. Heavy metal pollution, selection, and genome size: The species of the Žerjav study revisited with flow cytometry. Journal of Botany 2010: Article ID 596542, 11 pages.
CCDB · CromoCat 2015 — Baltisberger, M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:889-889
CCDB · CromoCat 2015 — Castro, M., Mateo, G. & Rosselló, J. A. (2007). Chromosome numbers in Hieracium and Pilosella species (Asteraceae) from the Iberian Peninsula and the Balearic
Islands Botanical Journal of the Linnean Society 153:311–320
CCDB · CromoCat 2015 — Dmitrieva, S. A. (1987). Kariologicheskaja kharakteristika nekotorykh predstaviteley sem. slozhnocvetnykh (Asteraceae Dumort.) flory Belorussii. Botanika (Minsk) 28: 23-33.
CCDB · CromoCat 2015 — Finch. (1982). Flora Europaea Check-list and Chromosome Index. In D.M. Moore. Cambridge Univ. Press Pp. 283-286.
CCDB · CromoCat 2015 — Lavrenko, A. N. & Serditov, N. P. (1987). Chromosome numbers in some members of the Urals flora (the Komi Autonomous Soviet Socialist Republic). Bot. Žurn. 72: 846-847.
CCDB · CromoCat 2015 — Lavrenko, A. N., Serditov, N. P. & Ulle, L. G. (1988). Chromosome numbers in some species of Asparagaceae, Asteraceae and Ranunculaceae from the north Urals (Komi ASSR). Bot. Žurn. 73: 605-607.
CCDB · CromoCat 2015 — Lavrenko, A. N., Serditov, N. P. & Ulle, L. G. (1990). Chromosome numbers in some species of flowering plants of the Urals ( the Komi Autonomus Soviet Socialist Republic). Bot. Žurn. 75: 1622-1624.
CCDB · CromoCat 2015 — Strid, A. & I. A. Andersson. (1985a). Chromosome numbers of Greek mountain plants. An annotated list of 115 species. Bot. Jahrb. Syst. 107: 203-228.
CCDB · CromoCat 2015 — Probatova, N. S. & Seledets, V. P. (2008). IAPT/IOPB Chromosome Data 5 Taxon 57(2): 553-562
2n 367×CCDB · hieracium · CCDB · ipcn-api-dl · CCDB · book-ipcn72 +1
CCDB · hieracium — Gadella & Kliphuis 1972; Finch ined. in D.M. Moore 1982; Nazarova 1984; Lavrenko et al. 1988
CCDB · ipcn-api-dl — Nazarova, E. A. 1984. Chromosome numbers in the Caucasian representatives of the families Asteraceae, Brassicaceae, Fabaceae, Limoniaceae. Bot. Zhurn. SSSR 69(7): 972–975. (In Russian).
CCDB · ipcn-api-dl — Schuhwerk, F. & W. Lippert. 1998. Chromosomenzahlen von Hieracium (Compositae, Lactuceae) Teil 2. Sendtnera 5: 269–286.
CCDB · book-ipcn72 — GADELLA, T., & E. KLIPHUIS. 1972. studies in chromosome numbers of Yugoslavian angiosperms. Acta Bot. Croatica 31: 91-103.
CCDB · CromoCat 2015 — Finch. (1982). Flora Europaea Check-list and Chromosome Index. In D.M. Moore. Cambridge Univ. Press Pp. 283-286.
CCDB · CromoCat 2015 — Lavrenko, A. N., Serditov, N. P. & Ulle, L. G. (1988). Chromosome numbers in some species of Asparagaceae, Asteraceae and Ranunculaceae from the north Urals (Komi ASSR). Bot. Žurn. 73: 605-607.
CCDB · CromoCat 2015 — Nazarova, E. (1984). Chromosome numbers in the Caucasian representatives of the families Asteraceae, Brassicaceae, Fabaceae, Limoniaceae. Bot. Žurn. 69(7): 972-975.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Baltisberger, M. (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:889-889
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
triploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type150 924 records
Wild obs. + sensor130 015
Museum / vouchered15 219
Cultivated / captive58
Other5 632
Origin
Native197
Introduced10
Range
Area of Occupancy AOO172 560 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy32% within 1 km
≤100 m 14 398≤1 km 16 502≤10 km 63 696>10 km 1 066
95 662 georeferenced · 34 353 without coordinates
Open the mapobservation + sensor130 015
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy34% within 1 km
≤100 m 849≤1 km 2 969≤10 km 6 445>10 km 935
11 198 georeferenced · 4 021 without coordinates
Open the institutions mapphysical evidence15 219
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 11
11 georeferenced · 47 without coordinates
Open the mapnot free-living58
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions77 of 166 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 6 692 |
| Uppsala, SE | 1 359 |
| Salzburg, AT | 800 |
| Mlocation not on record | 742 |
| BFLlocation not on record | 482 |
| BIO-UNIPIlocation not on record | 438 |
| MeiseBGlocation not on record | 429 |
| València, ES | 382 |
| Provincia di Livornolocation not on record | 366 |
| sonstHerblocation not on record | 236 |
| BDBClocation not on record | 219 |
| Görlitz, DE | 204 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 180 |
| BRNUlocation not on record | 156 |
| PRClocation not on record | 138 |
| Barcelona, ES | 119 |
| Berlin, DE | 113 |
| Trondheim, NO | 109 |
| Adam Mickiewicz University in Poznańlocation not on record | 102 |
| PrivatHerblocation not on record | 99 |
| GZUlocation not on record | 84 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 79 |
| BClocation not on record | 74 |
| H-Schuhwlocation not on record | 66 |
| MAlocation not on record | 62 |
| Frankfurt am Main | 52 |
| Wlocation not on record | 48 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 46 |
| Olocation not on record | 46 |
| University of Bayreuthlocation not on record | 44 |
| GJOlocation not on record | 41 |
| Karlsruhe, DE | 40 |
| Entomological Society of Latvialocation not on record | 40 |
| San Sebastián, ES | 30 |
| TROMlocation not on record | 29 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 26 |
| Moscow State Universitylocation not on record | 25 |
| Uniwersytet Warszawskilocation not on record | 22 |
| H-Gottschllocation not on record | 20 |
| Podgorica, ME | 19 |
| Acadia Universitylocation not on record | 19 |
| Salamanca, ES | 17 |
| STUlocation not on record | 17 |
| Pamplona, ES | 17 |
| Madrid, ES | 16 |
| Uniwersytet Śląski w Katowicachlocation not on record | 16 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 14 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 14 |
| Wayland Universitylocation not on record | 13 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 13 |
| Museo Achille Folettolocation not on record | 13 |
| KMNlocation not on record | 11 |
| Vitoria, ES | 11 |
| Fulda, DE | 10 |
| Saint John, CA | 10 |
| Natural History Museum Rotterdamlocation not on record | 10 |
| WTUlocation not on record | 9 |
| H-Dunkellocation not on record | 9 |
| NWLAlocation not on record | 9 |
| Uniwersytet Opolskilocation not on record | 9 |
| Ann Arbor, US | 9 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 9 |
| Vancouver, CA | 9 |
| Nijmegen, NL | 8 |
| Sant Julià de Lòria, AD | 7 |
| Bourges, FR | 7 |
| Sion, CH | 7 |
| Mount Annan, AU | 7 |
| Bronx, US | 7 |
| CICYTEXlocation not on record | 7 |
| H-Adlerlocation not on record | 7 |
| H-Meierottlocation not on record | 7 |
| Québec, CA | 6 |
| CJBNlocation not on record | 6 |
| Auckland, NZ | 6 |
| Herb. BBGlocation not on record | 6 |
| Philadelphia, US | 6 |
| New Haven, US | 5 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| Hobart, AU | 4 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 4 |
| SZUlocation not on record | 4 |
| Museo Jorge Gerholdlocation not on record | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Madison, US | 4 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 4 |
| M-VascularPlantslocation not on record | 4 |
| Museum für Naturkundelocation not on record | 4 |
| Paris, FR | 4 |
| H-AkrKGlocation not on record | 4 |
| Christchurch, NZ | 4 |
| Pullman, US | 3 |
| Museo Entomologico de Leonlocation not on record | 3 |
| Staten Island, US | 3 |
| Canberra, AU | 3 |
| NoColllocation not on record | 3 |
| LDlocation not on record | 3 |
| CJBGlocation not on record | 3 |
| Gijón, ES | 3 |
| Saint Louis, US | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| San Isidro, AR | 3 |
| UGentlocation not on record | 3 |
| München, DE | 3 |
| Universität Tübingenlocation not on record | 3 |
| Corvallis, US | 3 |
| Alicante, ES | 3 |
| Winterthur, CH | 3 |
| FLADlocation not on record | 3 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Namur, BE | 2 |
| Dresden, DE | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Edinburgh, GB | 2 |
| Philadelphia, US | 2 |
| Portland, US | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| LfUlocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Whitehorse, CA | 2 |
| Granada, ES | 2 |
| McWane Science Centerlocation not on record | 2 |
| Montréal, CA | 2 |
| DULlocation not on record | 2 |
| University of New Hampshirelocation not on record | 2 |
| University of Stellenboschlocation not on record | 2 |
| Beijing, CN | 2 |
| IBFlocation not on record | 2 |
| Badajoz, ES | 2 |
| Portland, US | 2 |
| Pamplona, ES | 1 |
| Tilburg, NL | 1 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 1 |
| Davis, US | 1 |
| Corrientes, AR | 1 |
| Musée des Confluenceslocation not on record | 1 |
| OLAlocation not on record | 1 |
| Sevilla, ES | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Victoria, CA | 1 |
| Monastir, TN | 1 |
| Macomb, US | 1 |
| Clocation not on record | 1 |
| Columbia, US | 1 |
| Turku, FI | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Toronto, CA | 1 |
| Claremont, US | 1 |
| Denver, US | 1 |
| Long Beach, US | 1 |
| St. Paul, US | 1 |
| Moscow, US | 1 |
| Rotorua, NZ | 1 |
| Kew, GB | 1 |
| South Kensington, GB | 1 |
| Miami, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Salvador, BR | 1 |
| University of Genevalocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| The CB Rhizobium Collectionlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Armidale, AU | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
166 institutions · 14 825 of 15 219 vouchered records shown · 247 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA16 detections
Where the DNA of Hieracium murorum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.6 °C 6.20–16.6
Seasonal swing summer↔winter15.7 °C
Max temp (day)17.6 °C 8.70–19.5
Min temp (night)9.10 °C 4.00–14.1
Precipitation79.8 mm/mo 66.0–110
Air humidity63.1 % 58.8–68.7
Moisture balance-20.6 mm/mo -49.1–49.1
Vapour deficit633 Pa 299–756
Wind speed4.10 m/s 2.70–5.00
Cloud cover39.1 % 33.4–48.5
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.