Hieracium lucidum

Guss. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Hieracium

At a glance

Occurrence records13

Data sources10

Biological traits2

DNA specimens1

eDNA detections1

Sources10 archives

Databases and archives Hieracium lucidum's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF13 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Hieracium lucidum, or Sicilian sparviere, is a flowering plant in the family Asteraceae. It is very similar to Hieracium cophanense. Hieracium lucidum is a perennial herb that prefers the northern slopes of chalky seaside cliffs exposed to wet winds, including sites rich in nitrates from sea bird droppings. Unlike most other hawkweeds, this species reproduces only from seeds.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVP

Life cycle & reproduction1

Life formperennial

Habitat & environment1

Climatetemperate

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hieracium lucidum has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMW325262.1 ↗683 bpItaly

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACTTGTACCAACAACTGGGAGACGGGGA …

Hieracium lucidum isolate Hluc_1-1-2_1.0 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS4

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Hieracium lucidum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1810×CCDB · ita-fl · CCDB · hieracium · CCDB · fl-europaea +2

CCDB · ita-fl — BRULLO S., CAMPO G., ROMANO S. - 2004 (2004). Indagini citotassonomiche sul genere Hieracium L. (Asteraceae) in Sicilia.. Informatore Botanico Italiano , 36(2): 481-485.

CCDB · ita-fl — MERXMUELLER H. - 1975. Diploide Hieracien.. Anal. Inst. Bot. Cavanilles , 32(2): 189-196.

CCDB · ita-fl — BRULLO S., PAVONE P. - 1978. Numeri cromosomici per la flora italiana:464-483.. Inform. Bot. Ital. , 10(2): 248-264.

CCDB · hieracium — Merxm?ller 1975; Brullo & Pavone 1978

CCDB · fl-europaea — MerxmUller, 1975

CCDB · mediterranean

CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Merxmuller, H. 1975. Diploide Hieracium. Anales Inst. Bot. Cavanilles 32: 189–196.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type13 records

Wild obs. + sensor2

Museum / vouchered11

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	5
BClocation not on record	2
Görlitz, DE	1
València, ES	1
Sevilla, ES	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1

6 institutions · 11 of 11 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Hieracium lucidum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.5 °C 18.5–18.5

Seasonal swing summer↔winter15.2 °C

Max temp (day)22.2 °C

Min temp (night)13.7 °C

Precipitation24.5 mm/mo

Air humidity54.4 %

Moisture balance-122 mm/mo

Vapour deficit970 Pa

Wind speed3.10 m/s

Cloud cover28.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)