Hieracium caespitosum

Dahlst., 1894 · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Hieracium

At a glance

Occurrence records930

Data sources7

Biological traits9

DNA specimens34

eDNA detections17

Sources7 archives

Databases and archives Hieracium caespitosum's data was compiled from.

GBIFGlobal Biodiversity Information Facility930 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics34 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources9 traits

Occurrence & distributionGBIF930 records

Environmental DNA1 datasets · 2 countries17 detections

DNA & barcodingBOLD · NCBI34 specimens

Genome at a glanceCCDB3.6 Gbp

02Traits & measurements

SourcesLEDA

Size & morphology2

Plant height0.225 m

Seed mass0.106 mg

Life cycle & reproduction4

Dispersal typehuman

Life spanperennial

Raunkiær life formhemicryptophyte

Seed number612

Habitat & environment1

Woodinessnon-woody

Physiology & chemistry2

Seed longevity index0

Specific leaf area (SLA)24.94 mm²/mg

05DNA & barcoding34 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hieracium caespitosum has left across the world's sequence archives.

At a glance

DNA specimens34

Marker genes8

GenBank sequences10

eDNA detections17

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMG219093.1 ↗347 bpCanada · 2006

ACGT

TGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCATC …

Pilosella caespitosa voucher AP054WP 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL2★rbcLa★ITS4★ITS2atpF-atpHrpoC1trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Hieracium caespitosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 618 600 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Hieracium caespitosum3.62 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 36 n = 18

Ploidypolyploid inferred

Chromosome records18–362n range36median36mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 362×CCDB · hieracium · CCDB · kew

CCDB · hieracium — Rosenberg 1906; Rosenberg 1907a; Gustafson 1933; Skalinska 1968; Skalinska et al. 1968; Gadella et al. 1970; Skalinska & Kubi?n 1972; Faasen & Nadeau 1976; Gadella 1984

CCDB · kew — Suda J, Krahulcova A, Travnicek P, Rosenbaumova R, Peckert T, Krahulec F. 2007. Genome size variation and species relationships in Hieracium sub-genus Pilosella (Asteraceae) as inferred by flow cytometry. Annals of Botany 100: 1323-1335.

2n 181×CCDB · hieracium

CCDB · hieracium — Skalinska et al. 1968; Skalinska & Kubi?n 1972

2n 271×CCDB · hieracium

CCDB · hieracium — Skalinska 1968

2n 451×CCDB · hieracium

CCDB · hieracium — Skalinska 1968

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type930 records

Wild obs. + sensor792

Museum / vouchered138

Origin

Introduced466

Range

Area of Occupancy AOO1 100 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 25≤1 km 109≤10 km 11

145 georeferenced · 647 without coordinates

Open the mapobservation + sensor792

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy41% within 1 km

≤100 m 6≤1 km 32≤10 km 55

93 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence138

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Wrocławskilocation not on record	64
Vancouver, CA	13
Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record	11
Uniwersytet Śląski w Katowicachlocation not on record	10
University of Guelph, OAC Herbariumlocation not on record	9
Wuzhou, CN	6
Naturalis Biodiversity Centerlocation not on record	3
Emporia, US	3
DOI/FWS, Kenai National Wildlife Refugelocation not on record	2
Uniwersytet Warszawskilocation not on record	2
Chongqing Museumlocation not on record	2
Beijing, CN	1
Bruce Peninsula National Parklocation not on record	1
New Brunswick, US	1
Tilburg, NL	1
University of British Columbia, Herbariumlocation not on record	1
Austin, US	1

17 institutions · 131 of 138 vouchered records shown · 7 without an institution code

09Environmental DNA17 detections

Where the DNA of Hieracium caespitosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.7 °C 13.5–19.2

Seasonal swing summer↔winter27.5 °C

Max temp (day)21.1 °C 16.8–24.0

Min temp (night)13.5 °C 8.90–16.6

Precipitation84.5 mm/mo 71.9–125

Air humidity59.4 % 57.0–62.9

Moisture balance-45.4 mm/mo -71.3–0.3

Vapour deficit785 Pa 600–944

Wind speed3.10 m/s 2.50–4.70

Cloud cover40.7 % 39.4–48.9

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)