Hibiscus martianus

Zucc. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Hibiscus

At a glance

Occurrence records1 088

Data sources6

Biological traits11

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Hibiscus martianus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 088 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Occurrence & distributionGBIF1 088 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 22

01Narrative

Hibiscus martianus là một loài thực vật có hoa trong họ Cẩm quỳ. Loài này được Zucc. mô tả khoa học đầu tiên năm 1851.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height0.6 m

Seed mass8.11 mg

Seed mass max8.1 mg

Seed mass min8.1 mg

Life cycle & reproduction2

Life formsubshrub or shrub

Life spanperennial

Habitat & environment4

Climatesubtropical

Climberself-supporting

Growth formSubshrub, Shrub, Forb/herb

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hibiscus martianus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

matKMZ394931.1 ↗1 106 bp

ACGT

TTCGTATTCATATGCATGAGAATTATATAGGAACAAGAATAATCTTGGATTCAAAATCCAAATAGATTTCTTTGGAGTAATAAACCTCTT …

Hibiscus martianus voucher Correll 32237 MO tRNA-Lys (trnK-UUU) gene, partial sequence; and maturase K (matK) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Hibiscus martianus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 221×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Skovsted 1941

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 088 records

Wild obs. + sensor884

Museum / vouchered204

Range

Area of Occupancy AOO2 200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 416≤1 km 135≤10 km 54>10 km 73

678 georeferenced · 206 without coordinates

Open the mapobservation + sensor884

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 104≤1 km 6≤10 km 28>10 km 5

143 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence204

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions16 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Austin, US	87
Mexico City, MX	40
Durango, MX	21
Austin, US	11
Bronx, US	10
Juriquilla, MX	10
Giardini Botanici Hanburylocation not on record	6
Phoenix, US	3
Wuzhou, CN	2
EL PASO, US	2
Jena Microbial Resource Collectionlocation not on record	2
Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record	2
San Diego, US	2
Chapingo, MX	1
Mexico City, MX	1
Claremont, US	1
Chicago, US	1
Saint Louis, US	1
Bloomington, US	1

19 institutions · 204 of 204 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hibiscus martianus

At a glance

Sources6 archives

Size & morphology4

Life cycle & reproduction2

Habitat & environment4

Physiology & chemistry1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 088 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions16 of 19 geolocated

Record type1 088 records