Hibiscus makinoi

Jôtani & H.Ohba · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Hibiscus

At a glance

Occurrence records276

Data sources9

Biological traits6

DNA specimens14

eDNA detections6

Sources9 archives

Databases and archives Hibiscus makinoi's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility276 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources6 traits

Occurrence & distributionGBIF276 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD · NCBI14 specimens

Genome at a glanceCCDB2n = 92

01Narrative

Hibiscus makinoi or Okinawan Hibiscus and Makino's Mallow is a species of Hibiscus found growing on the coast in Japan from the Ryukyu Islands to western Kyushu.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Deciduousnessdeciduous

Life formshrub

Life spanperennial

Habitat & environment2

Climatesubtropical

Growth formtree

⚠ sources differ — GIFT: tree · TRY: Shrub, treee (ST)

Physiology & chemistry1

Specific leaf area (SLA)20.75 mm²/mg

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hibiscus makinoi has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes3

GenBank sequences10

eDNA detections6

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLLC692591.1 ↗573 bpJapan · 2001

ACGT

AAGAGTATAAATTGACTTATTATACTCCTCAATATGAAGTCAAAGATACTGATATCTTGGCAGCCTTCCGAGTAACTCCTCAACCCGGAG …

Hibiscus makinoi TF<JPN>:TW019348 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL7trnH-psbA

plant barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Hibiscus makinoi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 92 n = 46

Ploidypolyploid inferred

Chromosome records92–922n range92median92mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 922×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Jotani, Y. & H. Ohba. 1984. A wild Hibiscus, H. makinoi, sp. nov. from S. W. Japan. J. Japan. Bot. 59: 214–222.

CCDB · ipcn-api-dl — Nakamura, T., N. Nomoto & Y. Jotani. 1986. The cytological studies in family Malvaceae III. Chromosome numbers and karyotypes in genus Hibiscus. CIS Chromosome Inform. Serv. 40: 31–32.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type276 records

Wild obs. + sensor117

Museum / vouchered159

Origin

Native1

Range

Area of Occupancy AOO608 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy75% within 1 km

≤100 m 44≤1 km 10≤10 km 1>10 km 17

72 georeferenced · 45 without coordinates

Open the mapobservation + sensor117

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy4% within 1 km

≤100 m 3≤10 km 74

77 georeferenced · 82 without coordinates

Open the institutions mapphysical evidence159

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Tsukuba, JP	94
Nishihara, JP	22
Nishihara, JP	10
Forestry and Forest Products Research Institutelocation not on record	4
Chiba, JP	3
Kagoshima, JP	3
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
Herbarium of the Kyushu University Museum (FU)location not on record	2
Saint Louis, US	2
Sanda, JP	2
BISHlocation not on record	1
TAIElocation not on record	1
Honolulu, US	1

13 institutions · 147 of 159 vouchered records shown · 12 without an institution code

09Environmental DNA6 detections

Where the DNA of Hibiscus makinoi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.9 °C 16.5–25.1

Seasonal swing summer↔winter12.8 °C

Max temp (day)21.8 °C 17.4–25.7

Min temp (night)19.9 °C 15.4–24.2

Precipitation239 mm/mo 171–385

Air humidity57.6 % 56.9–58.3

Moisture balance177 mm/mo

Vapour deficit1,072 Pa 794–1,320

Wind speed5.50 m/s

Cloud cover32.3 % 29.4–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)