Heteroclinus johnstoni

(Saville-Kent, 1886) · species

image placeholder — illustration coming later

Animalia/Chordata/Perciformes/Clinidae/Heteroclinus

At a glance

Occurrence records708

Data sources9

Biological traits6

DNA specimens3

eDNA detections3

Sources9 archives

Databases and archives Heteroclinus johnstoni's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility358 records↗

OBISOcean Biodiversity Information System350 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS708 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

01Narrative

Heteroclinus johnstoni, or Johnston's weedfish, is a species of clinid native to the waters along the around southern Australian coast where it prefers reefs with tall seaweed growth at depths down to about 50 m. This species can reach a maximum length of 40 cm TL. The specific name honours the statistician and scientist Robert Mackenzie Johnston (1843-1918).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length40 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Other traits3

Depth max50 m

Depth min0 m

Vulnerability30

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Heteroclinus johnstoni has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P607 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

CCCTTAGCCTCTTAATTCGAGCTGAACTAAGCCAGCCGGGGGCGCTACTAGGGGATGATCAAATCTATAACGTAATCGTTACTGCACACG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Heteroclinus tristissame genus9.9%Heteroclinus heptaeolussame genus9.9%Heteroclinus puellarumsame genus11.2%Heteroclinus perspicillatussame genus11.4%Heteroclinus roseussame genus11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type708 records

Wild obs. + sensor404

Museum / vouchered304

Range

Area of Occupancy AOO880 km²

Depth

0–200 m sunlit142

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5 m · max 20 m · 142 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 319≤1 km 14≤10 km 5

338 georeferenced · 66 without coordinates

Open the mapobservation + sensor404

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 4≤1 km 43≤10 km 96>10 km 8

151 georeferenced · 153 without coordinates

Open the institutions mapphysical evidence304

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
QVMAGlocation not on record	28
Museums Victorialocation not on record	20
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	15
Tasmanian Museum & Art Gallerylocation not on record	14
Sydney, AU	11
Australian National Fish Collectionlocation not on record	10
Western Australian Museumlocation not on record	4
	1

8 institutions · 103 of 304 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Heteroclinus johnstoni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 12.2–12.2

Seasonal swing summer↔winter5.80 °C

Max temp (day)13.8 °C

Min temp (night)10.9 °C

Precipitation79.7 mm/mo

Air humidity61.5 %

Moisture balance-52.3 mm/mo

Vapour deficit546 Pa

Wind speed3.80 m/s

Cloud cover40.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)