Heterocephalus glaber

Rüppell, 1842 · species

image placeholder — illustration coming later

Animalia/Chordata/Mammalia/Rodentia/Bathyergidae/Heterocephalus

At a glance

Occurrence records306

Data sources12

Biological traits25

DNA specimens19

eDNA detections1

Sources12 archives

Databases and archives Heterocephalus glaber's data was compiled from.

WikipediaWikimedia Foundation18 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility306 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements4 literature sources25 traits

Occurrence & distributionGBIF306 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD19 specimens

Genome at a glanceGoaT · NCBI2.8 Gbp

01Narrative

Various aged naked mole-rats. The naked mole-rat (Heterocephalus glaber), also known as the sand puppy, is a burrowing rodent native to parts of East Africa. It is closely related to the blesmols and is the only species in the genus Heterocephalus. The naked mole-rat exhibits a highly unusual set of physiological and behavioral traits that allow it to thrive in a harsh underground environment; most notably its being the only mammalian thermoconformer with an almost entirely ectothermic (cold-blooded) form of body temperature regulation, as well as exhibiting a complex social structure split between reproductive and non-reproductive castes, making it and the closely-related Damaraland mole-rat (Fukomys damarensis) the only widely recognized examples of eusociality (the highest classification of sociality) in mammals. The naked mole-rat lacks pain sensitivity in its skin, and has very low metabolic and respiratory rates. It is also remarkable for its longevity and its resistance to cancer and oxygen deprivation. While formerly considered to belong to the same family as other African mole-rats, Bathyergidae, more recent investigation places it in a separate family, Heterocephalidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPanTHERIAAnAgeAmnioteDBEltonTraits

Size & morphology3

Body mass39.36 g

⚠ sources differ — PanTHERIA: 39.36 g · AnAge: 35 g · AmnioteDB: 35 g · EltonTraits: 55 g

Head body length130 mm

SVL11.08 cm

Life cycle & reproduction8

Age at sexual maturity228 days

Gestation70.49 days

Growth rate0.005 /day

Litter size11.3

⚠ sources differ — PanTHERIA: 11.3 · AnAge: 7 · AmnioteDB: 8.95

Litters per year4.5 /year

⚠ sources differ — PanTHERIA: 4.5 /year · AnAge: 3.5 /year · AmnioteDB: 3.5 /year

Max. longevity120 months

⚠ sources differ — PanTHERIA: 120 months · AnAge: 372 months · AmnioteDB: 340 months

Neonate mass1.86 g

⚠ sources differ — PanTHERIA: 1.86 g · AnAge: 2 g · AmnioteDB: 1.94 g

Weaning age27.28 days

⚠ sources differ — PanTHERIA: 27.28 days · AmnioteDB: 35.81 days

Diet & foraging3

Breadth1

Plant other100 %

Trophic levelherbivore

Habitat & environment2

Habitat breadth1

Terrestriality1.00

Physiology & chemistry4

Body temperature305 K

Metabolic rate0.128 W

Precipitation mean34.35 mm

Temperature mean239 decidegC

Other traits5

Activity cycle2.00

Foraging stratumG

Home range0.004 km²

Interbirth interval81.1 days

Population density11 100 /km²

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Heterocephalus glaber has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes13

eDNA detections1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

4Gmostly conserved

67Tmostly conserved

91Tmostly conserved

100Gmostly conserved

106Cmostly conserved

166Avariable

277Cvariable

283Cvariable

286Gmostly conserved

328Amostly conserved

334Gmostly conserved

409Amostly conserved

415Cvariable

433Avariable

508Cmostly conserved

TACGTTGTACCTGCTATTTGGGGCATGAGCAGGAATAACTGGAACAGCCCTAAGCATTCTAATCCGTACTGAACTAGGGCAACCCGGTAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes3

BIN1

Most divergent pair1.5%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Netta rufinasame order15.7%Alcippe brunneasame order16.9%Tachybaptus ruficollissame order17.0%Macronus ptilosussame order17.2%Minla ignotinctasame order17.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5Patp6COIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6D-loop

animal barcodemitochondrialmarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_015112 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTBs-rRNAl-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Heterocephalus glaber carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 836 200 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Heterocephalus glaber2.84 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

07Deep time~32.8 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin32.8 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

How it livedPBDB

Environmentterrestrial

Life habitsemifossorial

Dietherbivore

Motilityactively mobile

Compositionhydroxyapatite

Reproductionviviparous

08Occurrence & distribution

Record type306 records

Wild obs. + sensor31

Museum / vouchered275

Origin

Native16

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 4≤1 km 8≤10 km 4>10 km 4

20 georeferenced · 11 without coordinates

Open the mapobservation + sensor31

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 5≤1 km 4≤10 km 44>10 km 29

82 georeferenced · 193 without coordinates

Open the institutions mapphysical evidence275

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cambridge, US	131
Seattle, US	40
Ann Arbor, US	33
Royal Museum for Central Africalocation not on record	10
Ithaca, US	9
Bonn, DE	8
Chicago, US	7
	6
National Museums of Kenyalocation not on record	6
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Berkeley, US	4
ASNHClocation not on record	3
Geneva, CH	3
Toronto, CA	3
CASlocation not on record	2
München, DE	2
Wuzhou, CN	1
Zacatecas, MX	1
Los Angeles, US	1
Washington, US	1

20 institutions · 275 of 275 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Heterocephalus glaber was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)