Hesperis matronalis
speciesAt a glance
Occurrence records116 024
Data sources16
Biological traits138
DNA specimens34
eDNA detections16
Sources16 archives
Databases and archives Hesperis matronalis's data was compiled from.
WikipediaWikimedia Foundation13 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility116 024 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics34 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources138 traits
Chemical compositionDukesPhytochem · LOTUS · NPASS105 compounds
Occurrence & distributionGBIF116 024 records
Environmental DNA1 datasets · 5 countries16 detections
DNA & barcodingBOLD · NCBI34 specimens
Genome at a glanceCCDB · GoaT8.2 Gbp
01Narrative
Foliage Hesperis matronalis is an herbaceous plant species in the family Brassicaceae. It has numerous common names, including dame's rocket, damask-violet, dame's-violet, dames-wort, dame's gilliflower, night-scented gilliflower, queen's gilliflower, rogue's gilliflower, summer lilac, sweet rocket, mother-of-the-evening, Good & Plenties, and winter gilliflower. These plants are biennials or short-lived perennials, native to Eurasia and cultivated in many other areas of the world for their attractive, spring-blooming flowers. In some of those areas, it has escaped from cultivation and become a weed species. The genus name Hesperis was probably given because the scent of the flowers becomes more conspicuous towards evening (Hespera is the Greek word for evening).
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology24
Fruit length35 mm
Fruit length max40 mm
Fruit length min30 mm
Fruit width1.75 mm
Fruit width max2 mm
Fruit width min1.5 mm
Leaf length40 mm
Leaf length max500 mm
Leaf length min20 mm
Leaf mass9.89 mg
Leaf size906 mm²
⚠ sources differ — LEDA: 906 mm² · GIFT: 2 468 mm²
Leaf width100 mm
Leaf width max100 mm
Leaf width min100 mm
Plant height0.745 m
⚠ sources differ — GIFT: 0.745 m · AusTraits: 0.8 m · LEDA: 0.353 m · USDA: 1.37 m · TRY: 0.625 m
Plant height generative0.7 m
Plant height max1 m
Plant height min0.1 m
Seed length2.92 mm
⚠ sources differ — TRY: 2.92 mm · GIFT: 4 mm
Seed length max4 mm
Seed length min4 mm
Seed mass2.58 mg
⚠ sources differ — TRY: 2.58 mg · LEDA: 2.6 mg · GIFT: 2.29 mg
Seed mass max2.8 mg
Seed mass min2.02 mg
Life cycle & reproduction35
After harvest regrowth rateSlow
Bloom periodSpring
Coppice potentialNo
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: anemochorous
Flower colourpurple
Flower conspicuousYes
Flowering endJul
Flowering startMay
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formbiennial or perennial
Life spanstrict monocarpic bi-annuals and poly-annuals
⚠ sources differ — TRY: strict monocarpic bi-annuals and poly-annuals · AusTraits: perennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: perennial
Lifespan categoryShort
Lifespan years2 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed spread rateModerate
Seedling vigorMedium
Self fertilizationpresent
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment30
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max2 100 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit typesilique
⚠ sources differ — AusTraits: silique · GIFT: capsule
Growth formherb
Growth form USDABunch
Habitat GIFTcut-over forest, dump, shrubberies
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Leaf shapeelliptical oblong ovate
Low growing grassNo
Mycorrhiza typeAMNM
Root depth min12 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry25
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min120 days
Leaf C:N ratio12.18 g/g
Leaf c411 mg/g
Leaf dry-matter content (LDMC)137 mg/g
⚠ sources differ — TRY: 137 mg/g · LEDA: 145 mg/g
Leaf n33.74 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min32 in
Protein potentialHigh
Salinity toleranceNone
Shade toleranceMedium
Soil pH max7 pH
Soil pH min5 pH
Specific leaf area (SLA)34.0 mm²/mg
⚠ sources differ — TRY: 34.0 mm²/mg · LEDA: 35.71 mm²/mg · GIFT: 33.21 mm²/mg
Temperature min-23 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound224 000 per lb
ToxicityNone
Veneer productNo
Other traits7
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max18 000 per acre
Planting density min4 800 per acre
03Chemical composition105 compounds
Compounds documented for Hesperis matronalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cooking💊 Medicinal use documented
Compound class profile5 classes
Acyclic monoterpenoids10
Flavonols8
Simple phenolic acids6
Menthane monoterpenoids $ Monocyclic monoterpenoids5
Pinane monoterpenoids4
Documented compounds105 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Sabinene | present | LOTUS | |
| (+)-taxifolin | present | NPASS | |
| (-)-alpha-Pinene | present | LOTUS | |
| (-)-beta-Pinene | present | LOTUS | |
| (-)-Linalool | present | LOTUS | |
| (1R,8S,9R,16R,18S,27S)-9-(3,4-dihydroxyphenyl)-5,8,16,21,23-pentahydroxy-2,10,17,26-tetraoxaheptacyclo[14.11.1.01,13.03,12.06,11.018,27.020,25]octacosa-3(12),4,6(11),13,20,22,24-heptaen-15-one | present | NPASS | |
| (3S)-2,2-dimethyl-3-[(2E)-3-methylpenta-2,4-dienyl]oxirane | present | LOTUS | |
| (E)-N-(2-hydroxyethyl)-3-[(S)-methylsulfinyl]prop-2-enamide | present | NPASS | |
| (E,E)-4,8,12-Trimethyl-1,3,7,11-tridecatetraene | present | LOTUS | |
| (L)-alpha-terpineol | present | LOTUS |
05DNA & barcoding34 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hesperis matronalis has left across the world's sequence archives.
At a glance
DNA specimens34
Marker genes10
GenBank sequences10
eDNA detections16
Countries6
The DNA barcodea real sequence read deposited for this species
TCGAATCCGTGGTCATGCGCTGCGTCCCCGCGGAGGGATTCGTCCCGAGCTGGACGCGCCCTTGGCTTCCGGACATAACAAAACCCCGGC …
Hesperis matronalis subsp. sintenisii KNYA:5640 genes for internal transcribed spacer 1, 5.8S ribosomal RNA and internal transcribed spacer 2, partial and complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL2★rbcLa★ITS7★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
animal barcodeplant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Hesperis matronalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size8 224 980 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Hesperis matronalis8.22 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidy4× tetraploid · measured
Chromosome records14–282n range24median24mode75records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2444×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · fl-europaea +10
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Dvořák F., 1964: Taxonomické závěry ze studia počtu chromosomů druhů rodu Hesperis L. - Preslia 36/2: 178-184+Tab. IX v prílohe časopisu.
CCDB · slov-fl — Dvořák F. & Dadáková B., 1975a: Karyological studies of Hesperis matronalis L. subsp. nivea (Baumg.) Kulcz. and Chorispora tenella (Pallas) DC. - Biologia (Bratislava) 30/4: 265-273.
CCDB · slov-fl — Dvořák F., 1982: Some results of the study of Hesperis matronalis L. from the Belanské Tatry Mts. - Biológia (Bratislava) 37/5: 441-447.
CCDB · fl-europaea — LOve & Lve, 1956
CCDB · poland — Pogan E., Czapik R. and Jankun A. et al. 1985. Further studies in chromosome numbers of Polish Angiosperms Part XVIII. Acta Biol. Cracov. Ser. Bot. 27, 57-74.
CCDB · book-ipcn65 — Dvofel 1964
CCDB · ipcn-api-dl — Gohil, R. N. & R. Raina. 1987. Polyploidy accompanied by structural alterations in the evolution of Hesperis matronalis L. Cytologia 52: 223–228.
CCDB · ipcn-api-dl — Dvorak, F. 1982. Some results of the study of Hesperis matronalis L. from the Belanske Tatry Mts. Biologia (Bratislava) 37: 441–447.
CCDB · ipcn-api-dl — Kiehn, M., E. Vitek & C. Dobea. 2000. In C. Dobea & E. Vitek, Documented Chromosome Number Checklist of Austrian Vascular Plants. Verlag des Naturhistorischen Museums Wien, Vienna.
CCDB · ipcn-api-dl — Dvorak, F. & B. Dadakova. 1975. Study of chromosomes of Angiosperms 2. Scripta Fac. Sci. Nat. Univ. Purkyn. Brun. 1.5: 31–50.
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK & A. Jankun. 1985. Further studies in chromosome numbers of Polish angiosperms. Part XVIII. Acta Biol. Cracov., Ser. Bot. 27: 57–74.
CCDB · book-indian_vol1 — Love, A. & Love, D. 1956b ; Baksay, L. 1957b; Dvohik, F. 1964
CCDB · eflora
CCDB · book-fedorov — Dvorak 1964c a/finiS
CCDB · book-fedorov — LOve A., LOve D. 195fib
CCDB · book-fedorov — Baksay 1957b
CCDB · book-fedorov — Dvorak 1964c
CCDB · brass — Kiehn et al.
CCDB · brass — Dvork
CCDB · brass — Manton
CCDB · brass — Lve & Lve
CCDB · brass — Dvork & Dadkov
CCDB · brass — Bhattacharyya
CCDB · brass — Baksay
CCDB · brass — Pogan et al.
CCDB · book-atlas-flowering-plants
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Danihelka, J. & Rotreklová, O. (2001a). Chromosome numbers within the Achillea millefolium and the A. distans groups in the Czech Republic and Slovakia. Folia Geobot., Praha 36: 163-191
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1956b). Cytotaxonomical conspectus of the Icelandic flora. Acta Horti Gothob. 20(4): 65-291.
CCDB · CromoCat 2015 — Pogan, E., R. Czapik & A. Jankun. (1985). Further studies in chromosome numbers of Polish Angiosperms. Part XVIII. Acta Biol. Cracov., Ser. Bot. 27: 57-74.
CCDB · CromoCat 2015 — Dvo?ák F. (1964). Taxonomické záv?ry ze studia po?tu chromosom? druh? rodu Hesperis L. Preslia 36: 178-184
CCDB · CromoCat 2015 — Dvorak, F. & Dadakova, B. (1976c). The chromosome morphology of Hesperis matronalis subsp. matronalis and related diploid taxa. Folia Geobot. Phytotax. (Bohem.) 11: 313-326.
CCDB · CromoCat 2015 — Manton, I. (1932a). Introduction to the general cytology of the Cruciferae. Ann. Bot. (London) 46(183): 509-556.
2n 1416×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · book-indian_vol1 +5
CCDB · ipcn-api-dl — Magulaev, A. V. 1984. Cytotaxonomic study in some flowering plants of the North Caucasus. Bot. Zhurn. SSSR 69(4): 511–517.
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · ipcn-api-dl — Belaeva, V. A. & V. N. SIPLIVINSKY. 1975. Chromosome numbers and taxonomy of some species of Baikal flora. Bot. Žhurn. (Moscow & Leningrad) 60(6): 864–872.
CCDB · book-ipcn73-74 — BHATTACHARYYA, N.K. 1974. Structure and behavior of chromosomes of t! varieties of Hesperis matronalis L. Cytologia 39: 275-282.
CCDB · book-indian_vol1 — Sokolovskaya, A.P. & Strelkova, O.S. (Fedorov)
CCDB · eflora
CCDB · book-fedorov — CoKOHOBCKan, CTPeHKoua 1948a
CCDB · brass — Bhattacharyya
CCDB · brass — Datta & Datta
CCDB · brass — Bolkhovskikh et al.
CCDB · brass — Magulaev
CCDB · brass — Belaeva & Siplivinsky
CCDB · Cave1963 — Easterly 1963
CCDB · CromoCat 2015 — Datta, S. & Datta, K. B. (1975b). Polyploidy in intraspecific differentiation of Hesperis matronalis L. (Cruciferae) Proc. Indian Sci. Congr. Assoc. 62: 126–127
CCDB · CromoCat 2015 — Hill, L. M. (1989). IOPB Chromosome Data 1 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 13: 17-19.
CCDB · CromoCat 2015 — Magulaev, A. Y. (1984). Cytotaxonomix study in some flowering plants of the North Caucasus. Bot. Žurn. 69: 511-517.
2n 2813×CCDB · slov-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +4
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · ipcn-api-dl — Murin, A. 1974. In Index of chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · ipcn-api-dl — Magulaev, A. V. 1984. Cytotaxonomic study in some flowering plants of the North Caucasus. Bot. Zhurn. SSSR 69(4): 511–517.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-indian_vol1 — Jaretzky, R. 1928a
CCDB · brass — Mjovsky et al.
CCDB · brass — Datta & Datta
CCDB · brass — Magulaev
CCDB · book-atlas-flowering-plants — Jaretzky 1928a
CCDB · CromoCat 2015 — Datta, S. & Datta, K. B. (1975b). Polyploidy in intraspecific differentiation of Hesperis matronalis L. (Cruciferae) Proc. Indian Sci. Congr. Assoc. 62: 126–127
CCDB · CromoCat 2015 — Hindakova, M. (1974). Index of chromosome numbers of Slovakian flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1-23.
CCDB · CromoCat 2015 — Murín, A. (1974). In Index of chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1-23.
CCDB · CromoCat 2015 — Dvorak, F. & Dadakova, B. (1975). Karyological studies of Hesperis matronalis L. ssp. nivea (Baumg.) Kulcz. and Chorispora tenella (Pallas) DC. Biologia (Bratislava) 30: 265–273
2n 262×CCDB · slov-fl · CCDB · CromoCat 2015
CCDB · slov-fl — Dvořák F. & Dadáková B., 1975a: Karyological studies of Hesperis matronalis L. subsp. nivea (Baumg.) Kulcz. and Chorispora tenella (Pallas) DC. - Biologia (Bratislava) 30/4: 265-273.
CCDB · CromoCat 2015 — Dvorak, F. & Dadakova, B. (1975). Karyological studies of Hesperis matronalis L. ssp. nivea (Baumg.) Kulcz. and Chorispora tenella (Pallas) DC. Biologia (Bratislava) 30: 265–273
n 76×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 +2
CCDB · ipcn-api-dl — Krasnoborov & Rostovtseva. 1975. Chromosome numbers of some plant species from the south of Siberia. Bot. Zhurn. SSSR 60: 853–860.
CCDB · book-ipcn75-78 — Krasnoborov & Rostovtseva 1975
CCDB · book-ipcn73-74 — BHATTACHARYYA, N.K. 1974. Structure and behavior of chromosomes of t! varieties of Hesperis matronalis L. Cytologia 39: 275-282.
CCDB · brass — Bhattacharyya
CCDB · brass — Krasnoborov & Rostovtzeva
CCDB · CromoCat 2015 — Delay, J. (1970a). Orophytes. Inf. Ann. Caryosyst. et Cytogenet. 4: 1-16.
n 125×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · brass +1
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · book-ipcn73-74 — DEN NIJS, J.C.M. 1974. Biosystematic studies of the Rumex acetosella complex I. Angiocarpy and chromosome numbers in France~ta Bot. Neerl. 23: 655-675.
CCDB · brass — Mulligan
CCDB · brass — Bhattacharyya
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
n 144×CCDB · brass · CCDB · CromoCat 2015
CCDB · brass — Hill
CCDB · brass — Jaretzky
CCDB · brass — Manton
CCDB · CromoCat 2015 — Hill, L. M. (1989). IOPB Chromosome Data 1 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 13: 17-19.
n 61×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Delay, J. (1970a). Orophytes. Inf. Ann. Caryosyst. et Cytogenet. 4: 1-16.
n 241×CCDB · brass
CCDB · brass — Gohil & Raina
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time~5.07 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin5.07 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type116 024 records
Wild obs. + sensor110 877
Museum / vouchered5 037
Cultivated / captive30
Other80
Origin
Native71
Introduced6 065
Range
Area of Occupancy AOO218 500 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy68% within 1 km
≤100 m 51 343≤1 km 15 938≤10 km 30 002>10 km 2 186
99 469 georeferenced · 11 408 without coordinates
Open the mapobservation + sensor110 877
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy50% within 1 km
≤100 m 570≤1 km 907≤10 km 1 038>10 km 436
2 951 georeferenced · 2 086 without coordinates
Open the institutions mapphysical evidence5 037
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 9>10 km 10
19 georeferenced · 11 without coordinates
Open the mapnot free-living30
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions169 of 275 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 285 |
| Chongqing Museumlocation not on record | 266 |
| LDlocation not on record | 238 |
| Philadelphia, US | 165 |
| Olocation not on record | 165 |
| Moscow State Universitylocation not on record | 129 |
| DAOlocation not on record | 121 |
| Trondheim, NO | 119 |
| KMNlocation not on record | 119 |
| MeiseBGlocation not on record | 115 |
| Tartu, EE | 105 |
| Wuzhou, CN | 104 |
| Oskarshamn, SE | 100 |
| Bergen, NO | 99 |
| SLU Artdatabankenlocation not on record | 95 |
| St. Paul, US | 82 |
| Madison, US | 75 |
| Québec, CA | 73 |
| Bronx, US | 70 |
| BFLlocation not on record | 66 |
| Chadron, US | 66 |
| Salzburg, AT | 60 |
| Oulu, FI | 55 |
| Allentown, US | 54 |
| Turku, FI | 45 |
| Adam Mickiewicz University in Poznańlocation not on record | 43 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 40 |
| Victoria, CA | 37 |
| Wlocation not on record | 37 |
| College Park, US | 36 |
| Université Lavallocation not on record | 36 |
| Ann Arbor, US | 34 |
| Saint Louis, US | 34 |
| New Haven, US | 34 |
| Bern, CH | 33 |
| BRNUlocation not on record | 30 |
| TROMlocation not on record | 30 |
| Provincia di Livornolocation not on record | 29 |
| Spearfish, US | 28 |
| McWane Science Centerlocation not on record | 28 |
| Denver, US | 27 |
| Görlitz, DE | 26 |
| Burlington, US | 25 |
| Bozeman, US | 25 |
| Jyväskylä, FI | 25 |
| South Kensington, GB | 24 |
| University of Stellenboschlocation not on record | 24 |
| Green Bay, US | 24 |
| Mlocation not on record | 23 |
| Acadia Universitylocation not on record | 23 |
| University of New Hampshirelocation not on record | 22 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 22 |
| DBF-NHMDlocation not on record | 21 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 21 |
| Uppsala, SE | 19 |
| Williamsburg, US | 19 |
| Uniwersytet Wrocławskilocation not on record | 19 |
| Toronto, CA | 18 |
| Montréal, CA | 18 |
| WTUlocation not on record | 17 |
| Bloomington, US | 17 |
| Kuopio, FI | 17 |
| TUR-Alocation not on record | 17 |
| Pullman, US | 16 |
| Berlin, DE | 16 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 15 |
| Corvallis, US | 15 |
| Moscow, US | 14 |
| Uniwersytet Warszawskilocation not on record | 14 |
| Canadian Department of Agriculturelocation not on record | 14 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 13 |
| Zürich, CH | 13 |
| Porrentruy, CH | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 12 |
| Missoula, US | 12 |
| Christchurch, NZ | 12 |
| Tampa, US | 11 |
| Pittsburg, US | 11 |
| Saint John, CA | 11 |
| Emporia, US | 10 |
| BClocation not on record | 10 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 10 |
| Whitewater, US | 10 |
| Brookings, US | 10 |
| University of Alberta Museumslocation not on record | 9 |
| Philadelphia, US | 9 |
| SZUlocation not on record | 9 |
| Portland, US | 9 |
| Natural History Museum Rotterdamlocation not on record | 9 |
| Pocatello, US | 9 |
| Porvoo, FI | 9 |
| Logan, US | 8 |
| Vancouver, CA | 8 |
| Bangkok, TH | 8 |
| Philadelphia, US | 8 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 8 |
| Zürich, CH | 7 |
| Keene State Universitylocation not on record | 7 |
| Frankfurt am Main | 7 |
| Johnson City, US | 7 |
| Museum of the Rockieslocation not on record | 7 |
| IDElocation not on record | 7 |
| Tallinn, EE | 7 |
| Frauenfeld, CH | 7 |
| Chicago, US | 7 |
| Paris, FR | 7 |
| WINlocation not on record | 6 |
| DULlocation not on record | 6 |
| Davenport, US | 6 |
| Fairfax, US | 6 |
| Stockholm, SE | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 6 |
| Millersville, US | 6 |
| Dekalb, US | 6 |
| New Brunswick, US | 6 |
| Riverside, US | 6 |
| Claremont, US | 6 |
| University of Guelph, OAC Herbariumlocation not on record | 5 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 5 |
| Waverly, US | 5 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 5 |
| Flagstaff, US | 5 |
| Auckland, NZ | 5 |
| Tilburg, NL | 5 |
| Barcelona, ES | 5 |
| Lord Fairfax Community Collegelocation not on record | 5 |
| Ypsilanti, US | 5 |
| Bourges, FR | 5 |
| Anchorage, US | 5 |
| US | 4 |
| MAlocation not on record | 4 |
| Washington, US | 4 |
| BDBClocation not on record | 4 |
| Harrisonburg, US | 4 |
| Springfield, US | 4 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 4 |
| Davis, US | 4 |
| Staten Island, US | 4 |
| Provo, US | 4 |
| Royal Botanical Gardenslocation not on record | 4 |
| Fulda, DE | 4 |
| Albuquerque, US | 4 |
| nbflocation not on record | 3 |
| CONCOLlocation not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Brussel, BE | 3 |
| Morgantown, US | 3 |
| Fayetteville, US | 3 |
| IWEP FEB RASlocation not on record | 3 |
| GB | 3 |
| BAYLUlocation not on record | 3 |
| Mohonk Preservelocation not on record | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Boise, US | 3 |
| Beijing, CN | 3 |
| Vitoria, ES | 3 |
| GJOlocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Dresden, DE | 3 |
| UGentlocation not on record | 3 |
| Durham, US | 3 |
| Mount Annan, AU | 3 |
| Whitehorse, CA | 3 |
| Caldwell, US | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Orem, US | 2 |
| Podgorica, ME | 2 |
| Portland, US | 2 |
| Kirksville, US | 2 |
| ZRC-SAZUlocation not on record | 2 |
| Uniwersytet Jagiellońskilocation not on record | 2 |
| Canberra, AU | 2 |
| Minia, EG | 2 |
| Jackson, US | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Tomioka, JP | 2 |
| Pacific Lutheran Universitylocation not on record | 2 |
| Tromso University Museumlocation not on record | 2 |
| Taipei, TW | 2 |
| Weber State Universitylocation not on record | 2 |
| Hudson, US | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| NMBU:MINAlocation not on record | 2 |
| Phoenix, US | 2 |
| Kew, GB | 2 |
| GZUlocation not on record | 2 |
| Karlsruhe, DE | 2 |
| PRClocation not on record | 2 |
| Mount Pleasant, US | 2 |
| Chapel Hill, US | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| University of Southern Mississippilocation not on record | 2 |
| Glarus, CH | 2 |
| Norfolk, US | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| BSBIlocation not on record | 2 |
| BIO-UNIPIlocation not on record | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| Forssa, FI | 2 |
| Armidale, AU | 1 |
| Durango, US | 1 |
| Henderson, US | 1 |
| Hamilton, US | 1 |
| OLAlocation not on record | 1 |
| Oswego, US | 1 |
| China Agricultural Universitylocation not on record | 1 |
| València, ES | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| CICYTEXlocation not on record | 1 |
| Rotorua, NZ | 1 |
| Nishihara, JP | 1 |
| Dover, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| NoColllocation not on record | 1 |
| Pamplona, ES | 1 |
| AUAlocation not on record | 1 |
| Lausanne, CH | 1 |
| Chiba, JP | 1 |
| Xiamen, CN | 1 |
| Little Rock, US | 1 |
| Richmond, US | 1 |
| Naturkundliche Sammlung Urilocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| München, DE | 1 |
| H-Hohlalocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Gijón, ES | 1 |
| Miami, US | 1 |
| Mexico City, MX | 1 |
| NBSIlocation not on record | 1 |
| Conway, US | 1 |
| Elikins, US | 1 |
| LPMMBHlocation not on record | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Lincoln, US | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Winterthur, CH | 1 |
| Long Beach, US | 1 |
| Madrid, ES | 1 |
| USFS/BHSClocation not on record | 1 |
| Garðabær, IS | 1 |
| Salamanca, ES | 1 |
| 1 | |
| Wellington, NZ | 1 |
| CASlocation not on record | 1 |
| Macomb, US | 1 |
| BioFokuslocation not on record | 1 |
| Arcata, US | 1 |
| Odawara, JP | 1 |
| Fredericksburg, US | 1 |
| University of Lethbridgelocation not on record | 1 |
| CJBGlocation not on record | 1 |
| San Francisco, US | 1 |
| Nijmegen, NL | 1 |
| Cheney, US | 1 |
| Hobart, AU | 1 |
| Fribourg, CH | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
| Northridge, US | 1 |
| Boumlocation not on record | 1 |
| Sanda, JP | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Austin, US | 1 |
| Angwin, US | 1 |
| Santa Barbara, US | 1 |
| Mississippi State, US | 1 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 |
| Chicago, US | 1 |
| Clemson, US | 1 |
| Chengdu, CN | 1 |
275 institutions · 4 700 of 5 037 vouchered records shown · 248 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA16 detections
Where the DNA of Hesperis matronalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found16
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 16 detections have coordinates
Open the map5 countries0
on tall herb river bank
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.2 °C 10.4–19.4
Seasonal swing summer↔winter26.2 °C
Max temp (day)19.2 °C 12.9–24.6
Min temp (night)9.30 °C 5.70–15.3
Precipitation83.4 mm/mo 57.9–112
Air humidity58.8 % 55.5–64.3
Moisture balance-39.3 mm/mo -69.7–32.0
Vapour deficit674 Pa 477–950
Wind speed3.60 m/s 2.30–4.30
Cloud cover44.8 % 39.6–59.5
CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.