Hesperantha coccinea

(Backh. & Harv.) Goldblatt & J.C.Manning · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Iridaceae/Hesperantha

At a glance

Occurrence records925

Data sources9

Biological traits35

DNA specimens0

eDNA detections1

Sources9 archives

Databases and archives Hesperantha coccinea's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility925 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Occurrence & distributionGBIF925 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 26

01Narrative

Hesperantha coccinea, the river lily, or crimson flag lily (syn. Schizostylis coccinea Backh. & Harv.), is a species of flowering plant in the iris family Iridaceae, native to Southern Africa and Zimbabwe. It is a semievergreen perennial growing to 60 cm tall, with slender lanceolate leaves up to 40 cm long and 1 cm broad. The flowers are red, occasionally pink or white, 30–35 mm long, with six petals; they are produced four to ten alternately on a spike in late summer to autumn. The Latin specific epithet coccinea means “bright red”.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYAusTraitsGIFT

Size & morphology15

Fruit length2 mm

Fruit width1 mm

Leaf length max300 mm

Leaf width10 mm

Leaf width max10 mm

Leaf width min10 mm

Plant height0.6 m

⚠ sources differ — GIFT: 0.6 m · TRY: 0.55 m

Plant height max0.9 m

Plant height min0.2 m

Seed length1.5 mm

Seed length max1.5 mm

Seed length min1.5 mm

Seed mass0.605 mg

Seed mass max0.6 mg

Seed mass min0.6 mg

Life cycle & reproduction8

Deciduousnessdeciduous

Dispersal typewater

Life formtuberous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formcryptophyte

Reproduction asexualpresent

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 745 m

Elevation min250 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTLowland

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hesperantha coccinea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLAJ309657.1 ↗1 335 bp

ACGT

TAAAGCAAGTGCTGGATTTAAAGCTGGTGTTAAAGATTACAGATTGACTTATTATACTCCGGAGTACGAAACCAAAGATACTGATATCTT …

Schizostylis coccinea chloroplast partial rbcL gene for ribulose-bisphosphate carboxylase large subunit

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Hesperantha coccinea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidydiploid inferred

Chromosome records26–282n range27median26mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 262×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71

CCDB · ipcn-api-dl — Chatterjee, A., S. Ghosh & S. C. Roy. 1989. A cytological survey of eastern Himalayan plants III. Cell Chromosome Res. 12: 22–29.

CCDB · book-ipcn67-71 — GOLDBLATT, P. 1971. Cytological and morphological studies in the Southern African Iridaceae. J.S. African Bot. 37: 317-460.

2n 282×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.

CCDB · book-ipcn75-78 — Sharma 1970

n 142×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.

CCDB · book-ipcn75-78 — Sharma 1970

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type925 records

Wild obs. + sensor630

Museum / vouchered282

Cultivated / captive13

Range

Area of Occupancy AOO2 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 337≤1 km 110≤10 km 33>10 km 21

501 georeferenced · 129 without coordinates

Open the mapobservation + sensor630

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 3≤1 km 13≤10 km 3

19 georeferenced · 263 without coordinates

Open the institutions mapphysical evidence282

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 5

5 georeferenced · 8 without coordinates

Open the mapnot free-living13

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	152
Durban, ZA	34
Auckland, NZ	21
Cape Town, ZA	14
Christchurch, NZ	12
Cape Town, ZA	10
Hobart, AU	10
Wellington, NZ	7
LNBG$location not on record	6
MSB-3054location not on record	3
South African National Biodiversity Institutelocation not on record	2
Vancouver, CA	1
Museo Entomologico de Leonlocation not on record	1
Denver, US	1
Rotorua, NZ	1
MeiseBGlocation not on record	1

16 institutions · 276 of 282 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Hesperantha coccinea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)