Hesperaloe parviflora

(Torr.) J.M.Coult. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asparagaceae/Hesperaloe

At a glance

Occurrence records257

Data sources10

Biological traits9

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Hesperaloe parviflora's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility257 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF257 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB · GoaT3.9 Gbp

01Narrative

Hesperaloe parviflora flowers Hesperaloe parviflora, also known as red yucca, hummingbird yucca, redflower false yucca and samandoque, is a plant that is native to Chihuahuan desert of west Texas east and south into central and south Texas and northeastern Mexico around Coahuila.http://swbiodiversity.org/seinet/taxa/index.php?taxon=17237 Southwest Biodiversity Hesperaloe parviflora has narrow evergreen leaves with a fringe of white threadlike hairs along their edges and grows in clumps 3 - high and wide. Red or yellow tubular flowers are borne on branching flower stalks (inflorescences) up to 5 ft tall from late spring to mid-summer.http://www.sanmarcosgrowers.com/products/plants/plantdisplay.asp?plant_id=831 San Marcos The Latin specific epithet parviflora means "with small flowers". This species has become popular in xeriscape landscape design for public and private gardens in California and the Southwestern United States. The plant's qualities include drought tolerance, heat resistance, low maintenance needs, hummingbird attracting flowers,http://ag.arizona.edu/pima/gardening/aridplants/Hesperaloe_parviflora.html University of Arizona and an architectural form. It also is a spineless alternative to Agave and Yucca horticultural species.[1] San Marcos

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Subshrub, Forb/herb

Woodinessnon-woody

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hesperaloe parviflora has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences9

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSU24039.1 ↗239 bp

ACGT

TCGCGTCGCTCCGCGCACCCCTGCCCCCACCCAGTGTGGGCAGATGTTAGCGTGGACGCGGATATTGGCCCCCCGTGCCTTGCGGTGCGG …

Hesperaloe parviflora 5.8S-26S rDNA internal transcribed spacer 2 (ITS2)

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Hesperaloe parviflora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size3 912 000 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Hesperaloe parviflora3.91 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 60 n = 30

Chromosome records60–602n range60median60mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 603×GoaT · Kew Plant DNA C-values Database · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · book-fedorov — McKelvey, Sax 1933

CCDB · book-atlas-flowering-plants — McKelvey & S. '33

08Occurrence & distribution

Record type257 records

Wild obs. + sensor168

Museum / vouchered88

Cultivated / captive1

Range

Area of Occupancy AOO756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 99≤1 km 15≤10 km 11>10 km 6

131 georeferenced · 37 without coordinates

Open the mapobservation + sensor168

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 13≤1 km 20≤10 km 8>10 km 2

43 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence88

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ASUlocation not on record	17
Austin, US	17
Denton, US	7
Phoenix, US	6
Fort Worth, US	4
Bangkok, TH	4
Bronx, US	4
Austin, US	3
Chicago, US	3
Denver, US	3
EL PASO, US	2
Riverside, US	2
Saint Louis, US	2
Chongqing Museumlocation not on record	2
Lubbock, US	1
Pretoria, ZA	1
US	1
Chapingo, MX	1
Moscow, US	1
Mexico City, MX	1
Auckland, NZ	1
Clemson, US	1
Pullman, US	1
Santa Barbara, US	1

24 institutions · 86 of 88 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Hesperaloe parviflora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.6 °C 16.6–16.6

Seasonal swing summer↔winter22.8 °C

Max temp (day)19.4 °C

Min temp (night)12.6 °C

Precipitation347 mm/mo

Air humidity66.8 %

Moisture balance218 mm/mo

Vapour deficit623 Pa

Wind speed2.30 m/s

Cloud cover33.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)