Herniaria glabra
speciesAt a glance
Occurrence records66 336
Data sources15
Biological traits56
DNA specimens27
eDNA detections14
Sources15 archives
Databases and archives Herniaria glabra's data was compiled from.
WikipediaWikimedia Foundation12 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility66 336 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics27 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources56 traits
Chemical compositionLOTUS · NPASS13 compounds
Occurrence & distributionGBIF66 336 records
Environmental DNA1 datasets · 4 countries14 detections
DNA & barcodingBOLD · NCBI27 specimens
Genome at a glanceCCDB · GoaT513 Mbp
01Narrative
Herniaria glabra, the smooth rupturewort, is a plant of the family Caryophyllaceae, and grows in North America and Europe. It contains herniarin, a methoxy analog of umbelliferone.Herniarin on www.liberherbarum.com
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology22
Fruit length2 mm
Fruit length max2 mm
Fruit length min2 mm
Leaf length5 mm
Leaf length max7 mm
Leaf length min3 mm
Leaf mass0.25 mg
Leaf size32 mm²
⚠ sources differ — TRY: 32 mm² · LEDA: 7.55 mm² · GIFT: 7.55 mm²
Leaf width2 mm
Leaf width max3 mm
Leaf width min1 mm
Plant height0.085 m
⚠ sources differ — GIFT: 0.085 m · LEDA: 0.06 m · TRY: 0.02 m
Plant height generative0.095 m
Plant height max0.3 m
Plant height min0.01 m
Seed length0.445 mm
Seed mass0.086 mg
⚠ sources differ — TRY: 0.086 mg · LEDA: 0.077 mg · GIFT: 0.081 mg
Seed mass max0.12 mg
Seed mass min0.05 mg
Seed volume0.065 mm³
Seed volume max0.065 mm³
Seed volume min0.065 mm³
Life cycle & reproduction14
Deciduousnessevergreen
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: autochorous
Flowering endAug
Flowering startJul
Life formannual or subshrub
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: annual
Lifespan years1.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Seed number1 005
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 400 m
Elevation mean2 075 m
Elevation min900 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTrivers, roadsides, sand, stony places
Woodinessnon-woody
Physiology & chemistry5
Leaf C:N ratio19.42 g/g
Leaf dry-matter content (LDMC)200 mg/g
Leaf n20.7 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)9.09 mm²/mg
⚠ sources differ — TRY: 9.09 mm²/mg · LEDA: 19.93 mm²/mg · GIFT: 19.93 mm²/mg
Other traits1
Diaspore typefruit with appendage
03Chemical composition13 compounds
Compounds documented for Herniaria glabra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cholestane steroids5
Oleanane triterpenoids3
Cholestane steroids $ Stigmastane steroids2
Cholestane steroids $ Ergostane steroids1
Stigmastane steroids1
Documented compounds13 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2S,3R,4S,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-2-acetyloxy-8a-[(2S,3R,4S,5S,6R)-3-[(2S,3R,4S,5S,6R)-6-[[(2R,3R,4R,5S,6R)-3,4-dihydroxy-6-(hydroxymethyl)-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-2-yl]oxymethyl]-3,4,5-trihydroxyoxan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxycarbonyl-3-hydroxy-4,6a,6b,11,11,14b-hexamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicene-4-carboxylic acid | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(2S,3R,4S,4aR,6aR,6bS,8aS,12aS,14aR,14bR)-4-carboxy-8a-[(2S,3R,4S,5S,6R)-4,5-diacetyloxy-3-[(2S,3R,4R,5S,6S)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-methyloxan-2-yl]oxycarbonyl-2-hydroxy-4,6a,6b,11,11,14b-hexamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3,4,5-trihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (2S,3S,4S,5R,6R)-6-[[(2S,3R,4S,4aS,6aR,6bS,8aS,12aS,14aR,14bR)-8a-[(2S,3R,4S,5S,6R)-5-acetyloxy-3-[(2S,3R,4R,5S,6S)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxycarbonyl-4-carboxy-2-hydroxy-4,6a,6b,11,11,14b-hexamethyl-1,2,3,4a,5,6,7,8,9,10,12,12a,14,14a-tetradecahydropicen-3-yl]oxy]-3,4,5-trihydroxyoxane-2-carboxylic acid | present | LOTUS | |
| (5S,8R,9S,10S,13R,14S,17R)-10,13-dimethyl-17-[(2R)-6-methyl-5-methylideneheptan-2-yl]-1,2,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-3-one | present | NPASS | |
| (5S,8R,9S,10S,13R,14S,17R)-10,13-dimethyl-17-[(E,2S)-5-methylhex-3-en-2-yl]-1,2,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-3-one | present | NPASS | |
| (5S,8R,9S,10S,13R,14S,17R)-10,13-dimethyl-17-[(E,2S)-6-methylhept-3-en-2-yl]-1,2,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-3-one | present | NPASS | |
| (5S,8R,9S,10S,13R,14S,17R)-10,13-dimethyl-17-[(E,2S,5S)-5-methylhept-3-en-2-yl]-1,2,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-3-one | present | NPASS | |
| (5S,8R,9S,10S,13R,14S,17R)-17-[(E,2S,5R)-5,6-dimethylhept-3-en-2-yl]-10,13-dimethyl-1,2,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydrocyclopenta[a]phenanthren-3-one | present | NPASS | |
| 5alpha-Campestan-3-one | present | NPASS | |
| 5alpha-Cholestan-3-one | present | NPASS |
05DNA & barcoding27 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Herniaria glabra has left across the world's sequence archives.
At a glance
DNA specimens27
Marker genes5
GenBank sequences10
eDNA detections14
Countries6
The DNA barcodea real sequence read deposited for this species
AGACCGGGGGCAACCCCGGGCACCTAAACGAACTCCGGCGCGGACTGCGCCAAGGAACATGAAACTCAATGTGCGCACCTCCCCCATGCC …
Herniaria glabra voucher AT24-0025 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL7★rbcLa★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Herniaria glabra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size513 450 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Herniaria glabra0.51 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 18 n = 9
Ploidy2× diploid · measured
Chromosome records18–542n range18median18mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1829×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +12
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Murín A. & Feráková V., 1981: Karyological study of Slovakian flora III. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 28: 59-62.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · brit-fl — Blackburn, K.B., Morton, J.K. New Phytol. 56: 344-351 (1957)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1944
CCDB · fl-europaea — Blackburn &
CCDB · poland — Pogan E., Czapik R., Jankun A., Kuta E. et al. 1982 a. Further studies in chromosome numbers of Polish Angiosperms. Part XV. Acta Biol. Cracov. Ser. Bot. 24, 91-126.
CCDB · mediterranean
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK, A. Jankun & E. Kuta. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XV. Acta Biol. Cracov., Ser. Bot. 24: 113–126.
CCDB · ipcn-api-dl — Aryavand, A. & C. Favarger. 1980. Contribution a l'etude cytotaxonomique des Caryophyllacees de l'Iran. Biol. Ecol. Medit. 7: 15–26.
CCDB · ipcn-api-dl — Baltisberger, M. 1987. Chromosomenzahlen einiger Pflanzen aus Albanien. Ber. Geobot. Inst. ETH Stiftung Rübel 53: 47–63.
CCDB · ipcn-api-dl — Çelebio|3glu, T. & C. Favarger. 1993. Mediterranean chromosome number reports 3 (125--166). Fl. Medit. 3: 323–333.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Murin, A. & V. Ferakova. 1981. Caryological study of Slovakian flora III. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 28: 59–62.
CCDB · book-indian_vol1 — Scheerer, H. 1939 ; USve, A. & USve, D. 1944b ; Blackburn, K.B. & Adams, A.W. 1955
CCDB · book-fedorov — Scheerer 1939
CCDB · book-fedorov — Love A., Liive D. 1944b
CCDB · book-fedorov — Blackburn, Adams 1955
CCDB · book-atlas-flowering-plants — L. &L. 1944b
CCDB · kew — Hanson L, Leitch IJ, Bennett MD. Unpublished data from the Jodrell Laboratory, Royal Botanic Gardens, Kew
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
CCDB · CromoCat 2015 — Aryavand, A. & Favarger, C. (1980). Contribution à l'étude cytotaxonomique des Caryophyllacées de l'Iran. Biol. & Écol. Médit. 7: 15-26.
CCDB · CromoCat 2015 — Baltisberger, M. (1987b). Chromosomenzahlen einiger Labiaten aus Albanien. Ber. Geobot. Inst. E.T.H. Stiftung Rübel 57: 165-181.
CCDB · CromoCat 2015 — Çelebioglu, T. & Favarger, C. (1993). Rapports (125-166). Fl. Medit. 3: 323-333.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1944b). Cytotaxonomical studies on boreal plants. III. Some new chromosome numbers of Scandinavian plants. Arkiv. for Bot. Band 314(12): 1-22.
CCDB · CromoCat 2015 — Pogan, E., R. Czapik, A. Jankun & E. Kuta. (1982b). Further studies in chromosome numbers of Polish Angiosperms. Part XV. Acta Biol. Cracov., Ser. Bot. 24: 91-126.
CCDB · CromoCat 2015 — Blackburn, K. B. & Adams, A. W. (1955). Cytology in Herniaria. Proc. Bot. Soc. Brit. Isles 1: 380.
CCDB · CromoCat 2015 — Scheerer, H. (1939). Chromosomenzahlen aus der schleswig-holsteinischen Flora. I. Planta 29: 636-642.
2n 363×CCDB · mediterranean · CCDB · CromoCat 2015
CCDB · mediterranean
CCDB · CromoCat 2015 — Çelebioglu, T. & Favarger, C. (1993). Rapports (125-166). Fl. Medit. 3: 323-333.
CCDB · CromoCat 2015 — Cheshmedziev, I. V. (1994). Reports (313-366). Fl. Medit. 4: 269-279.
2n 541×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Probatova, N.S.& Kazanovsky, S.G.& Rudyka, E.G. & Seledets, V.P. & Nechaev,V.A (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:899-902
n 91×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type66 336 records
Wild obs. + sensor60 287
Museum / vouchered5 738
Cultivated / captive16
Other295
Origin
Native373
Introduced113
Range
Area of Occupancy AOO109 676 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy40% within 1 km
≤100 m 15 072≤1 km 5 942≤10 km 30 627>10 km 451
52 092 georeferenced · 8 195 without coordinates
Open the mapobservation + sensor60 287
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy36% within 1 km
≤100 m 403≤1 km 786≤10 km 1 547>10 km 536
3 272 georeferenced · 2 466 without coordinates
Open the institutions mapphysical evidence5 738
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 15
16 georeferenced
Open the mapnot free-living16
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions78 of 167 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 591 |
| Helsinki, FI | 417 |
| LDlocation not on record | 344 |
| Bratislava, SK | 339 |
| Moscow State Universitylocation not on record | 260 |
| MeiseBGlocation not on record | 217 |
| Olocation not on record | 152 |
| SLU Artdatabankenlocation not on record | 141 |
| Salzburg, AT | 127 |
| Oskarshamn, SE | 103 |
| CJBGlocation not on record | 99 |
| Zürich, CH | 97 |
| Provincia di Livornolocation not on record | 90 |
| Tartu, EE | 86 |
| BDBClocation not on record | 84 |
| Turku, FI | 83 |
| BFLlocation not on record | 74 |
| València, ES | 73 |
| Görlitz, DE | 71 |
| Uniwersytet Warszawskilocation not on record | 71 |
| MAlocation not on record | 68 |
| Kuopio, FI | 66 |
| Adam Mickiewicz University in Poznańlocation not on record | 64 |
| Barcelona, ES | 63 |
| Bern, CH | 61 |
| GJOlocation not on record | 56 |
| BIO-UNIPIlocation not on record | 52 |
| Uppsala, SE | 52 |
| BClocation not on record | 51 |
| Philadelphia, US | 49 |
| Oulu, FI | 46 |
| Zürich, CH | 43 |
| BRNUlocation not on record | 43 |
| Berlin, DE | 43 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 39 |
| Museo Entomologico de Leonlocation not on record | 38 |
| TUR-Alocation not on record | 36 |
| Entomological Society of Latvialocation not on record | 33 |
| Tallinn, EE | 30 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 25 |
| Salamanca, ES | 24 |
| Trondheim, NO | 23 |
| Wlocation not on record | 23 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 22 |
| Frankfurt am Main | 21 |
| Vitoria, ES | 21 |
| Mlocation not on record | 20 |
| South Kensington, GB | 19 |
| KMNlocation not on record | 19 |
| Stockholm, SE | 16 |
| DBF-NHMDlocation not on record | 16 |
| Madrid, ES | 16 |
| Urumqi, CN | 14 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 12 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| CICYTEXlocation not on record | 12 |
| Jyväskylä, FI | 12 |
| Phyletisches Museum Jenalocation not on record | 11 |
| PRClocation not on record | 10 |
| Tilburg, NL | 10 |
| LfUlocation not on record | 9 |
| Beijing, CN | 8 |
| SZUlocation not on record | 7 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 7 |
| Paris, FR | 7 |
| No collectionlocation not on record | 7 |
| Fulda, DE | 6 |
| Porrentruy, CH | 6 |
| Dresden, DE | 6 |
| Bergen, NO | 6 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 5 |
| WNNUlocation not on record | 5 |
| Gijón, ES | 4 |
| Université Lavallocation not on record | 4 |
| Granada, ES | 4 |
| Jaén, ES | 4 |
| TROMlocation not on record | 4 |
| Wellington, NZ | 4 |
| Montréal, CA | 4 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 4 |
| Ann Arbor, US | 4 |
| Philadelphia, US | 3 |
| National Museum Waleslocation not on record | 3 |
| Vancouver, CA | 3 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| NMBU:MINAlocation not on record | 3 |
| UGentlocation not on record | 3 |
| Badajoz, ES | 3 |
| Uniwersytet Śląski w Katowicachlocation not on record | 3 |
| Frauenfeld, CH | 3 |
| Chongqing Museumlocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| Namur, BE | 3 |
| Karlsruhe, DE | 2 |
| Porvoo, FI | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Podgorica, ME | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Winterthur, CH | 2 |
| Herb. BBGlocation not on record | 2 |
| Bourges, FR | 2 |
| H-Schuhwlocation not on record | 2 |
| BSBIlocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| H-Hohlalocation not on record | 2 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Québec, CA | 2 |
| Salvador, BR | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 2 |
| nbflocation not on record | 2 |
| Saint Louis, US | 2 |
| Royal Ontario Museumlocation not on record | 2 |
| Nijmegen, NL | 2 |
| BMlocation not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Saint John, CA | 1 |
| Brussel, BE | 1 |
| GZUlocation not on record | 1 |
| BGBMlocation not on record | 1 |
| RJBJCIlocation not on record | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Tromso University Museumlocation not on record | 1 |
| Xiamen, CN | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| WTUlocation not on record | 1 |
| US | 1 |
| Sion, CH | 1 |
| Durham, US | 1 |
| Denver, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Macomb, US | 1 |
| Monastir, TN | 1 |
| Taipei, TW | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| San Sebastián, ES | 1 |
| St. Paul, US | 1 |
| CJBNlocation not on record | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| Sevilla, ES | 1 |
| NMWlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Hobart, AU | 1 |
| ASUlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| München, DE | 1 |
| Pullman, US | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Cambridge University Herbariumlocation not on record | 1 |
| Christchurch, NZ | 1 |
| sonstHerblocation not on record | 1 |
| Alicante, ES | 1 |
| ROM020location not on record | 1 |
| Santiago de Compostela, ES | 1 |
| University of Birminghamlocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Kunming, CN | 1 |
| Bronx, US | 1 |
| Corvallis, US | 1 |
| University of Readinglocation not on record | 1 |
| Rishon Le Zion, IL | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Kew, GB | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
167 institutions · 5 062 of 5 738 vouchered records shown · 607 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA14 detections
Where the DNA of Herniaria glabra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found14
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 14 detections have coordinates
Open the map4 countries0
In cultivated flower bed
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median17.0 °C 9.80–17.3
Seasonal swing summer↔winter15.3 °C
Max temp (day)18.5 °C 13.5–21.1
Min temp (night)12.9 °C 6.70–14.9
Precipitation59.4 mm/mo 53.8–132
Air humidity60.8 % 60.0–64.1
Moisture balance-50.0 mm/mo
Vapour deficit758 Pa 418–778
Wind speed3.20 m/s
Cloud cover42.5 % 37.6–52.3
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.