Hermeuptychia intricata

Grishin, 2014 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Nymphalidae/Hermeuptychia

At a glance

Occurrence records763

Data sources6

Biological traits0

DNA specimens22

eDNA detections4

Sources6 archives

Databases and archives Hermeuptychia intricata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility763 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF763 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD22 specimens

01Narrative

Hermeuptychia intricata is a butterfly of the family Nymphalidae. It has been recorded from the coastal plains of the eastern United States and is currently documented from Texas, Louisiana, Florida, South Carolina, and North Carolina. The length of the forewings is 16.5 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hermeuptychia intricata has left across the world's sequence archives.

At a glance

DNA specimens22

BINs1

Marker genes2

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

79Tmostly conserved

106Cmostly conserved

346Cmostly conserved

529Tmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAATTGGTACATCATTAAGTTTAATTATCCGAATAGAATTAGGTAATCCAGGATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes5

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hermeuptychia gisellasame genus2.1%Hermeuptychia hermessame genus2.3%Hermeuptychia cucullinasame genus2.3%Hermeuptychia isabellasame genus3.5%Hermeuptychia hermybiussame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type763 records

Wild obs. + sensor733

Museum / vouchered30

Range

Area of Occupancy AOO1 756 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 274≤1 km 179≤10 km 86>10 km 33

572 georeferenced · 161 without coordinates

Open the mapobservation + sensor733

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤1 km 1≤10 km 7>10 km 1

10 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Universidad del Valle de Guatemalalocation not on record	12
New Haven, US	3
Washington, US	1

3 institutions · 16 of 30 vouchered records shown · 10 without an institution code

09Environmental DNA4 detections

Where the DNA of Hermeuptychia intricata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 16.2–24.9

Seasonal swing summer↔winter27.0 °C

Max temp (day)30.7 °C 22.1–30.7

Min temp (night)20.6 °C 11.9–20.6

Precipitation115 mm/mo 90.2–115

Air humidity56.8 % 56.8–57.2

Moisture balance-74.9 mm/mo -74.9–-49.3

Vapour deficit1,370 Pa 924–1,370

Wind speed4.90 m/s 4.90–5.50

Cloud cover25.6 % 25.6–33.4

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)