Hermania scabra

(O.F.Müller, 1784) · species

image placeholder — illustration coming later

Animalia/Mollusca/Gastropoda/Cephalaspidea/Philinidae/Hermania

At a glance

Occurrence records11 164

Data sources7

Biological traits2

DNA specimens19

eDNA detections1

Sources7 archives

Databases and archives Hermania scabra's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 112 records↗

OBISOcean Biodiversity Information System4 052 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS11 164 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD19 specimens

01Narrative

Hermania scabra is a species of gastropods belonging to the family Philinidae. MolluscaBase eds. (2022). MolluscaBase. Hermania scabra (O. F. Müller, 1784). Accessed through: World Register of Marine Species at: https://marinespecies.org/aphia.php?p=taxdetails&id=867492 on 2022-01-08 The species is found in Europe.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hermania scabra has left across the world's sequence archives.

At a glance

DNA specimens19

BINs2

Marker genes1

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

49Gmostly conserved

50Tmostly conserved

56Tmostly conserved

85Gmostly conserved

95Tmostly conserved

241Gmostly conserved

268Tmostly conserved

280Cmostly conserved

289Tmostly conserved

340Cmostly conserved

346Cmostly conserved

415Amostly conserved

430Amostly conserved

481Tmostly conserved

494Tmostly conserved

514Amostly conserved

517Tmostly conserved

613Cmostly conserved

652Tmostly conserved

GACATTATATATAATTTTTGGAATGTGATGTGGGTTAGTCGGAACTGGGTTAAGTTTATTAATTCGTTTTGAACTAGGAACTGCGTCTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes6

BIN1

Most divergent pair1.1%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hermania indistinctasame genus7.6%Philinopsis speciosasame order15.3%Philinopsis depictasame order15.7%Sagaminopteron nigropunctatumsame order15.9%Camachoaglaja africanasame order16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type11 164 records

Wild obs. + sensor3 599

Museum / vouchered5 526

Fossil1

Other2 038

Range

Area of Occupancy AOO9 760 km²

Depth

0–200 m sunlit3 078

200–1000 m twilight236

1–4 km midnight0

>4 km abyssal0

median 72.9 m · max 639 m · 3 314 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 3 162≤1 km 12≤10 km 74>10 km 1

3 249 georeferenced · 350 without coordinates

Open the mapobservation + sensor3 599

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 107≤1 km 502≤10 km 64>10 km 3

676 georeferenced · 4 850 without coordinates

Open the institutions mapphysical evidence5 526

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bergen, NO	474
730location not on record	143
CEFASlocation not on record	132
NTNU-VMlocation not on record	111
Gothenburg, SE	87
MZLUlocation not on record	82
SLU Artdatabankenlocation not on record	63
Paris, FR	17
Tromsø, NO	15
DASSHlocation not on record	15
BioFokuslocation not on record	12
Natural History Museum Rotterdamlocation not on record	11
630location not on record	6
PNHSlocation not on record	5
Stockholm, SE	4
Norwegian Institute of Marine Researchlocation not on record	4
ULiègelocation not on record	3
Cambridge, US	2
Bergen, NO	1
Hellenic Centre of Marine Research; Institute for Oceanographylocation not on record	1
Denver, US	1
Biomorlocation not on record	1
Goteborg Natural History Museumlocation not on record	1

23 institutions · 1 191 of 5 526 vouchered records shown · 2 038 without an institution code

09Environmental DNA1 detections

Where the DNA of Hermania scabra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

Mixed bottom

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.8 °C 10.8–10.8

Seasonal swing summer↔winter16.1 °C

Max temp (day)12.2 °C

Min temp (night)9.40 °C

Precipitation48.8 mm/mo

Air humidity59.1 %

Vapour deficit531 Pa

Cloud cover45.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hermania scabra

At a glance

Sources7 archives

Habitat & environment2

At a glance

Record type11 164 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type11 164 records