Herklotsichthys punctatus

(Rüppell, 1837) · species

image placeholder — illustration coming later

Animalia/Chordata/Clupeiformes/Clupeidae/Herklotsichthys

At a glance

Occurrence records149

Data sources9

Biological traits8

DNA specimens10

eDNA detections9

Sources9 archives

Databases and archives Herklotsichthys punctatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility91 records↗

OBISOcean Biodiversity Information System58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources8 traits

Occurrence & distributionGBIF · OBIS149 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD10 specimens

01Narrative

Herklotsichthys punctatus, the spotback herring or spotted herring, is a species of herring from the family Clupeidae from the western Indian Ocean, the Red Sea and more recently the Levantine Sea in the eastern Mediterranean Sea by Lessepsian migration via the Suez Canal.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length11.7 cm

Body mass15 g

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-neritic

Uses & economy1

Commercial importanceminor commercial

Other traits3

Depth max50 m

Depth min0 m

Vulnerability10

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Herklotsichthys punctatus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P663 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

8Cmostly conserved

10Cmostly conserved

12Tmostly conserved

13Tmostly conserved

14Amostly conserved

16Cmostly conserved

17Tmostly conserved

19Gmostly conserved

20Tmostly conserved

21Amostly conserved

22Tmostly conserved

23Tmostly conserved

24Tmostly conserved

25Gmostly conserved

27Tmostly conserved

28Gmostly conserved

29Cmostly conserved

30Tmostly conserved

31Tmostly conserved

33Gmostly conserved

34Gmostly conserved

35Cmostly conserved

36Amostly conserved

38Gmostly conserved

40Amostly conserved

41Tmostly conserved

42Amostly conserved

43Gmostly conserved

44Tmostly conserved

45Amostly conserved

46Gmostly conserved

47Gmostly conserved

66Tmostly conserved

77Amostly conserved

132Cvariable

ATCGGCACCCTTTATCTAGTATTTGGTGCTTGGGCAGGAATAGTAGGCACCGCCCTAAGCCTTCTTATTCGGGCAGAGCTCAGCCAACCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes6

BIN1

Most divergent pair0.45%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Herklotsichthys losseisame genus9.2%Chromis atrilobatasame order17.0%Percina aurorasame order17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type149 records

Wild obs. + sensor63

Museum / vouchered85

Other1

Origin

Native5

Range

Area of Occupancy AOO256 km²

Depth

0–200 m sunlit14

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 19 m · max 50 m · 14 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 8≤1 km 21≤10 km 3

32 georeferenced · 31 without coordinates

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy64% within 1 km

≤100 m 18≤10 km 6>10 km 4

28 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence85

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	13
National Natural History Collectionslocation not on record	7
SMNHTAUlocation not on record	5
Frankfurt am Main	5
CASlocation not on record	2
SEAOBISlocation not on record	2
Cantablocation not on record	2
Copenhagen, DK	2
FishBaselocation not on record	1
Helsinki, FI	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
Cambridge, US	1
Washington, US	1
	1

14 institutions · 44 of 85 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Herklotsichthys punctatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

MarineSandy bottom

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.10 °C 8.10–19.7

Seasonal swing summer↔winter16.7 °C

Max temp (day)11.9 °C 11.9–22.0

Min temp (night)4.20 °C 4.20–17.2

Precipitation137 mm/mo 110–137

Air humidity57.5 % 56.7–57.5

Moisture balance69.5 mm/mo

Vapour deficit460 Pa 460–999

Wind speed3.70 m/s

Cloud cover37.4 % 33.4–37.4

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)