Herklotsichthys koningsbergeri

(Weber & de Beaufort, 1912) · species

image placeholder — illustration coming later

Animalia/Chordata/Clupeiformes/Clupeidae/Herklotsichthys

At a glance

Occurrence records1 074

Data sources8

Biological traits9

DNA specimens10

eDNA detections9

Sources8 archives

Databases and archives Herklotsichthys koningsbergeri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility301 records↗

OBISOcean Biodiversity Information System773 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources9 traits

Occurrence & distributionGBIF · OBIS1 074 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD10 specimens

01Narrative

Herklotsichthys koningsbergeri is een straalvinnige vissensoort uit de familie van de haringen (Clupeidae). De wetenschappelijke naam is gepubliceerd in 1912 door Weber en De Beaufort.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length13 cm

Habitat & environment4

Habitat brackishyes

Habitat freshwateryes

Habitat saltwateryes

Habitat zonepelagic-neritic

Uses & economy1

Commercial importancesubsistence fisheries

Other traits3

Depth max50 m

Depth min0 m

Vulnerability10

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Herklotsichthys koningsbergeri has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.31%

Haplotypes1

BIN1

Where individuals differ — all 7 variable positions, in barcode order

51Gmostly conserved

52Cmostly conserved

54Tmostly conserved

56Cmostly conserved

109Cvariable

220Cmostly conserved

565Gmostly conserved

CCTTTATCTAGTATTTGGTGCCTGAGCAGGGATGGTAGGAACCGCCCTGAGCCTTCTCATCCGAGCAGAGCTGAGCCAGCCTGGCGCACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Herklotsichthys lippasame genus15.3%Herklotsichthys quadrimaculatussame genus16.6%Alosa pseudoharengussame family16.7%Sardinella sindensissame order16.8%Sardinella gibbosasame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 074 records

Wild obs. + sensor604

Museum / vouchered470

Range

Area of Occupancy AOO1 108 km²

Depth

0–200 m sunlit503

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 16 m · max 76.5 m · 503 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 599≤10 km 1

604 georeferenced

Open the mapobservation + sensor604

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy40% within 1 km

≤100 m 18≤1 km 94≤10 km 140>10 km 26

278 georeferenced · 192 without coordinates

Open the institutions mapphysical evidence470

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	60
DEWlocation not on record	49
Sydney, AU	44
Museum and Art Gallery of the Northern Territorylocation not on record	26
Western Australian Museumlocation not on record	14
Natick, US	13
South Kensington, GB	5
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	5
CSIRO, Australian National Fish Collectionlocation not on record	2
University of California San Diegolocation not on record	1

10 institutions · 219 of 470 vouchered records shown

09Environmental DNA9 detections

Where the DNA of Herklotsichthys koningsbergeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.6 °C 23.6–28.4

Seasonal swing summer↔winter7.20 °C

Max temp (day)27.8 °C 25.5–29.4

Min temp (night)25.4 °C 21.7–27.3

Precipitation168 mm/mo 81.0–318

Air humidity63.5 % 61.6–64.1

Vapour deficit1,315 Pa 1,068–1,417

Cloud cover54.6 % 33.7–72.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Herklotsichthys koningsbergeri

At a glance

Sources8 archives

Size & morphology1

Habitat & environment4

Uses & economy1

Other traits3

At a glance

Record type1 074 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 10 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 074 records