Heritiera utilis

(Sprague) Sprague · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Heritiera

At a glance

Occurrence records225

Data sources10

Biological traits20

DNA specimens8

eDNA detections4

Sources10 archives

Databases and archives Heritiera utilis's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility225 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources20 traits

Occurrence & distributionGBIF225 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD · NCBI8 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Heritiera utilis is a species of flowering plant in the family Malvaceae (or Sterculiaceae). It is found in Ivory Coast, Gabon, Ghana, Liberia, and Sierra Leone. It is threatened by habitat loss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height30 m

Plant height max27.43 m

Plant height min22.86 m

Seed mass1 152 mg

Seed mass max1 152 mg

Seed mass min1 152 mg

Life cycle & reproduction5

Deciduousnessevergreen

Dispersal typewind

Life formtree

Life spanperennial

Raunkiær life formphanerophyte

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry4

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)16 mm²/mg

Wood density558 mg/cm³

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Heritiera utilis has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes3

GenBank sequences2

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

rbcLMN366833.1 ↗528 bp

ACGT

GTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAGTCAAGGATACTGATATCTTGGCAGCCTTCCGAGTAACTCCTCAACCC …

Heritiera utilis voucher IDRCG407-13_WH213a_221 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★rbcLa

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Heritiera utilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Chromosome records32–322n range32median32mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 322×CCDB · book-fedorov · CCDB · Cave1957

CCDB · book-fedorov — Mangenot 8., Mangenot G. 1957

CCDB · Cave1957 — Mangenot & Mangenot

08Occurrence & distribution

Record type225 records

Wild obs. + sensor117

Museum / vouchered108

Range

Area of Occupancy AOO268 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced · 111 without coordinates

Open the mapobservation + sensor117

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 107 without coordinates

Open the institutions mapphysical evidence108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BRLUlocation not on record	19
Institut de Recherche Agronomique de Guinée (IRAG)location not on record	15
Saint Louis, US	5
WAGlocation not on record	3
Daubeny Herbarium, Oxfordlocation not on record	3
Kew, GB	2
Plocation not on record	2
Paris, FR	1
CJBGlocation not on record	1
Universite Libre de Bruxelles, Herbariumlocation not on record	1
Herbier National du Gabonlocation not on record	1

11 institutions · 53 of 108 vouchered records shown · 55 without an institution code

09Environmental DNA4 detections

Where the DNA of Heritiera utilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.7 °C 25.6–27.0

Seasonal swing summer↔winter2.90 °C

Max temp (day)30.1 °C 29.5–30.7

Min temp (night)23.5 °C 22.1–24.5

Precipitation114 mm/mo 57.3–177

Air humidity68.6 % 67.6–68.7

Moisture balance-25.4 mm/mo -86.6–37.2

Vapour deficit1,093 Pa 1,025–1,155

Wind speed1.90 m/s 1.30–2.50

Cloud cover21.1 % 17.0–34.5

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)