Heritiera javanica

(Blume) Kosterm. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Heritiera

At a glance

Occurrence records69

Data sources8

Biological traits13

DNA specimens6

eDNA detections2

Sources8 archives

Databases and archives Heritiera javanica's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility69 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF69 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI6 specimens

01Narrative

Heritiera javanica is a species of tree in the family Malvaceae, subfamily Sterculioideae. Like other species in this subfamily, flowers are unisexual; trees may grows up to 40 m high, and their Vietnamese name (under H. cochinchinensis) is huỷnh. No subspecies are listed in the Catalogue of Life.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height30 m

Plant height max42 m

Life cycle & reproduction4

Deciduousnessevergreen

Dispersal typewind

Life formtree

Life spanperennial

Habitat & environment5

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Wood density620 mg/cm³

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Heritiera javanica has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences4

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLAB925312.1 ↗531 bpCambodia · 2010

ACGT

GTTAAAGAGTATAAATTGACTTATTATACTCCTGAATATGAAGTCAAAGATACTGATATCTTGGCAGCCTTCCGAGTAACTCCTCAACCC …

Heritiera javanica chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds, specimen_voucher: KYUM<JPN>:28

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type69 records

Wild obs. + sensor39

Museum / vouchered30

Range

Area of Occupancy AOO180 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 28≤1 km 1≤10 km 1

30 georeferenced · 9 without coordinates

Open the mapobservation + sensor39

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 30 records without

Open the institutions mapphysical evidence30

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	3
Cibinong Science Center, Herbarium Bogorienselocation not on record	2
National Institute of Biological Resourceslocation not on record	1

3 institutions · 6 of 30 vouchered records shown · 24 without an institution code

09Environmental DNA2 detections

Where the DNA of Heritiera javanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.0 °C 27.0–27.0

Seasonal swing summer↔winter1.20 °C

Max temp (day)29.5 °C

Min temp (night)24.9 °C

Precipitation273 mm/mo

Air humidity68.2 %

Moisture balance125 mm/mo

Vapour deficit1,126 Pa

Wind speed0.9 m/s

Cloud cover50.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)