Herina frondescentiae

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Ulidiidae/Herina

At a glance

Occurrence records3 051

Data sources7

Biological traits1

DNA specimens33

eDNA detections42

Sources7 archives

Databases and archives Herina frondescentiae's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 051 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI42 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics33 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF3 051 records

Environmental DNA3 datasets · 6 countries42 detections

DNA & barcodingBOLD33 specimens

01Narrative

Herina frondescentiae is a species of picture-winged fly in the genus Herina of the family Ulidiidae It is wetland species of about 3 - in length. found in Sweden, Finland, Denmark, Latvia, the United Kingdom, Ireland, France, Netherlands, Germany, Spain, Andorra, Italy, Hungary, Romania, Albania, Ukraine, Croatia, Estonia, Poland, Lithuania, the Czech Republic, Slovakia, and Switzerland.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (adult)saprophagous

05DNA & barcoding33 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Herina frondescentiae has left across the world's sequence archives.

At a glance

DNA specimens33

BINs1

Marker genes1

eDNA detections42

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

20Amostly conserved

35Gmostly conserved

158Gmostly conserved

272Avariable

362Tvariable

368Amostly conserved

464Gmostly conserved

476Gmostly conserved

599Tmostly conserved

623Amostly conserved

CACTTTATTTTATCTTCGGAGCTTGAGCCGGAATGGTAGGGACTTCCCTTAGAATCCTTATTCGTGCCGAACTTGGACACCCAGGAGCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes10

BIN1

Most divergent pair2.0%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Herina nigribasissame genus11.5%Melieria pictasame family13.4%Melieria crassipennissame family13.4%Ceroxys urticaesame family13.8%Herina palustrissame genus13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 051 records

Wild obs. + sensor2 650

Museum / vouchered401

Range

Area of Occupancy AOO5 552 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 1 514≤1 km 576≤10 km 470>10 km 11

2 571 georeferenced · 79 without coordinates

Open the mapobservation + sensor2 650

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 189≤1 km 46≤10 km 49>10 km 1

285 georeferenced · 116 without coordinates

Open the institutions mapphysical evidence401

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	88
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	56
MZLUlocation not on record	29
CBDClocation not on record	25
University of Tokyo, Department of Zoologylocation not on record	23
Gothenburg, SE	22
Helsinki, FI	19
DFFW2018location not on record	18
ZMAAlocation not on record	16
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	13
NHMOlocation not on record	11
Stockholm, SE	10
Tromsø, NO	6
South Kensington, GB	6
Philadelphia, US	6
Natural History Museum, Londonlocation not on record	5
Metsähallituslocation not on record	4
Wellcome Sanger Institutelocation not on record	4
neflocation not on record	4
BioFokuslocation not on record	3
NCMGlocation not on record	3
DFlocation not on record	3
Rovaniemi, FI	2
Natural History Museum Rotterdamlocation not on record	2

24 institutions · 378 of 401 vouchered records shown · 23 without an institution code

09Environmental DNA42 detections

Where the DNA of Herina frondescentiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found42

Studies independent surveys3

Countries6

Verifiable raw sequence linked14

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 42 detections have coordinates

Open the map6 countries0

Fen edgeBog edge in alpine birch forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 5.50–14.6

Seasonal swing summer↔winter19.3 °C

Max temp (day)14.2 °C 9.90–18.0

Min temp (night)8.20 °C -0.3–10.9

Precipitation91.4 mm/mo 49.3–209

Air humidity64.1 % 58.9–65.2

Moisture balance-5.70 mm/mo -65.5–134

Vapour deficit502 Pa 321–683

Wind speed4.60 m/s 2.80–6.40

Cloud cover49.6 % 38.7–52.5

CHELSA 1981–2010, ~9 km grid, at location & month of 42 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Herina frondescentiae

At a glance

Sources7 archives

Diet & foraging1

At a glance

Record type3 051 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 051 records