Heriades leavitti

Crawford, 1913 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Megachilidae/Heriades

At a glance

Occurrence records396

Data sources7

Biological traits1

DNA specimens25

eDNA detections27

Sources7 archives

Databases and archives Heriades leavitti's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility396 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF396 records

Environmental DNA1 datasets · 2 countries27 detections

DNA & barcodingBOLD25 specimens

01Narrative

Heriades leavitti is a species of bee in the family Megachilidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology1

Intertegular distance (ITD)1.75 mm

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Heriades leavitti has left across the world's sequence archives.

At a glance

DNA specimens25

BINs1

Marker genes1

eDNA detections27

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

337Cmostly conserved

AGTAATATATATAATTTTTGCAATATGAGCCGGAATAATTGGATCTGCTATAAGAATTATTATTCGAATAGAATTAAGAACTTCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.11%

Haplotypes5

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Heriades brunerisame genus3.2%Heriades graciliorsame genus5.9%Heriades timberlakeisame genus7.9%Heriades cressonisame genus8.5%Heriades sauterisame genus9.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type396 records

Wild obs. + sensor19

Museum / vouchered377

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 8≤1 km 10

18 georeferenced · 1 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 1≤1 km 6≤10 km 54>10 km 1

62 georeferenced · 315 without coordinates

Open the institutions mapphysical evidence377

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toronto, CA	68
Champaign, US	46
	42
US	39
WIlocation not on record	22
FWSlocation not on record	19
Lake Placid, US	17
University Park, US	15
Beltsville, US	12
CER-UADYlocation not on record	11
Cambridge, US	7
Wuzhou, CN	6
LULlocation not on record	6
White River Junction, US	6
Saint John, CA	5
Mississippi State, US	4
IEXA-INECOLlocation not on record	4
Lexington, US	3
Montgomery, US	3
Philadelphia, US	2
OSUClocation not on record	2
Blacksburg, US	1
Washington, US	1
UNHClocation not on record	1
Decorah, US	1
KUNHM-ENTlocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

27 institutions · 345 of 377 vouchered records shown · 32 without an institution code

09Environmental DNA27 detections

Where the DNA of Heriades leavitti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map2 countries0

Mixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 16.3–22.7

Seasonal swing summer↔winter26.1 °C

Max temp (day)25.6 °C 21.9–27.0

Min temp (night)17.7 °C 12.2–20.3

Precipitation87.3 mm/mo 76.8–123

Air humidity58.0 % 57.8–62.5

Moisture balance-59.8 mm/mo -65.6–48.5

Vapour deficit1,068 Pa 779–1,140

Wind speed2.70 m/s 2.00–5.80

Cloud cover38.8 % 33.2–41.2

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)