Heraclides rogeri

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Papilionidae/Heraclides

At a glance

Occurrence records424

Data sources4

Biological traits0

DNA specimens12

eDNA detections9

Sources4 archives

Databases and archives Heraclides rogeri's data was compiled from.

GBIFGlobal Biodiversity Information Facility424 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF424 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD12 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Heraclides rogeri has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections9

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

100Tmostly conserved

299Amostly conserved

373Tmostly conserved

466Gmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCAAGAATATTAGGAACTTCCCTTAGTTTACTAATTCGAACCGAATTAGGAACCCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.22%

Haplotypes3

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Heraclides idaeussame genus1.8%Papilio erostratussame family3.5%Papilio pelaussame family3.6%Heraclides lamarcheisame genus6.2%Heraclides hectoridessame genus6.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type424 records

Wild obs. + sensor424

Range

Area of Occupancy AOO1 208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 175≤1 km 61≤10 km 28>10 km 31

295 georeferenced · 129 without coordinates

Open the mapobservation + sensor424

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA9 detections

Where the DNA of Heraclides rogeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.3 °C 23.7–27.6

Seasonal swing summer↔winter5.40 °C

Max temp (day)32.3 °C 28.0–33.4

Min temp (night)22.6 °C 19.8–23.7

Precipitation111 mm/mo 40.7–191

Air humidity63.0 % 57.2–63.4

Moisture balance-18.4 mm/mo -115–34.2

Vapour deficit1,361 Pa 1,110–1,436

Wind speed1.60 m/s 1.20–2.00

Cloud cover28.9 % 25.0–34.5

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)