Heracleum sphondylium
speciesAt a glance
Occurrence records816 218
Data sources14
Biological traits50
DNA specimens63
eDNA detections35
Sources14 archives
Databases and archives Heracleum sphondylium's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility816 218 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics63 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources50 traits
Chemical compositionLOTUS · NPASS175 compounds
Occurrence & distributionGBIF816 218 records
Environmental DNA1 datasets · 6 countries35 detections
DNA & barcodingBOLD · NCBI63 specimens
Genome at a glanceCCDB · GoaT · NCBI2.4 Gbp
01Narrative
Heracleum sphondylium, la Berce sphondyle, Berce spondyle, Berce commune ou grande Berce, est une espèce de plante à fleurs la famille des apiacées. C'est une plante herbacée vivace, voire bisannuelle, dont l'aire de répartition correspond aux prairies d'Eurasie. Généralement haute de 50 et 150 cm, elle atteint exceptionnellement 2 m. Affectionnant les sols riches et humides, elle est commune dans les lisières, les fossés, les lieux embroussaillés, certains prés et aux abords des haies, notamment en moyenne montagne humide. Entièrement comestible, elle est aussi photosensibilisante et peut causer des brûlures de la peau, après contact avec la sève suivi d'une exposition à la lumière du soleil, chez les personnes qui y sont sensibles. Il ne faut pas la confondre avec la Berce du Caucase, une espèce exotique envahissante nettement plus grande, également connue pour causer de fortes brûlures par photosensibilisation et qui peut atteindre 4 m de hauteur.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology14
Fruit length8 mm
Leaf length max120 mm
Leaf mass4 625 mg
Leaf size11 511 mm²
⚠ sources differ — TRY: 11 511 mm² · LEDA: 96 832 mm² · GIFT: 81 951 mm²
Plant height1.23 m
⚠ sources differ — GIFT: 1.23 m · LEDA: 0.963 m · TRY: 0.22 m
Plant height generative1.08 m
Plant height max2 m
Plant height min0.5 m
Seed length7.83 mm
Seed length max8 mm
Seed length min8 mm
Seed mass7.4 mg
⚠ sources differ — TRY: 7.4 mg · LEDA: 5.88 mg · GIFT: 6.24 mg
Seed mass max12.15 mg
Seed mass min5.16 mg
Life cycle & reproduction13
Deciduousnessdeciduous
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flowering endAug
Flowering startJun
Life formbiennial or perennial
Life spanperennial
Lifespan years3.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number5 800
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max3 400 m
Elevation min2 100 m
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest edges, meadows, mountains
Mycorrhizaabsent
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry9
Leaf C:N ratio17.65 g/g
Leaf c405 mg/g
Leaf dry-matter content (LDMC)216 mg/g
Leaf n26.81 mg/g
Leaf p3.36 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)21.5 mm²/mg
Wood density90.52 mg/cm³
Other traits1
Diaspore typegenerative dispersule
03Chemical composition175 compounds
Compounds documented for Heracleum sphondylium across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Friedelane triterpenoids14
Lupane triterpenoids13
Furocoumarins10
Megastigmanes10
Cinnamic acids and derivatives9
Documented compounds175 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-8-Methoxyisolariciresinol | present | NPASS | |
| (+)-Abscisic acid beta-D-glucopyranosyl ester | present | NPASS | |
| (+)-alpha-Pinene | present | NPASS | |
| (+)-Byakangelicin | present | LOTUS | |
| (+)-Erythrodiol | present | NPASS | |
| (+)-Lyoniresinol | present | NPASS | |
| (+)-Ursolic Acid | present | NPASS | |
| (-)-Isolariciresinol | present | NPASS | |
| (1R,2R,4aS,6aR,6aR,6bR,8aR,10S,12aR,14aR,14bS)-1,2,4a,6a,6b,9,9,12a-octamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14,14a,14b-hexadecahydropicene-2,10-diol | present | NPASS | |
| (1R,3aR,5aR,5bR,7aR,11aR,11bR,13aR,13bR)-1-[(2R)-1-hydroxypropan-2-yl]-3a,5a,5b,8,8,11a-hexamethyl-2,3,4,5,6,7,7a,10,11,11b,12,13,13a,13b-tetradecahydro-1H-cyclopenta[a]chrysen-9-one | present | NPASS |
05DNA & barcoding63 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Heracleum sphondylium has left across the world's sequence archives.
At a glance
DNA specimens63
Marker genes6
GenBank sequences10
eDNA detections35
Countries8
The DNA barcodea real sequence read deposited for this species
TCGAATCCTGCAATAGCAGAATGACCCGCTAACATGTAATTACATCGGGCAAGCGTATGGGGGCTTTGGTCCCCTGTTAGCAAAACCCTG …
Heracleum sphondylium subsp. sibiricum isolate 17-KOMI internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL2★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Heracleum sphondylium carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 376 540 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Heracleum sphondylium2.38 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 22 n = 11
Ploidy2× diploid · measured
Chromosome records22–242n range22median22mode79records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2278×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl +15
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — TONASCIA N. - 1992. Biosystematic investigations on Heracleum sphondylium s.l. in Switzerland.. Ber. Geobot. Inst. E.T.H., Stiftung Rubel , 58: 101-120.
CCDB · ita-fl — WEIMARCK G. - 1978 (1977). B chromosomes in Heracleum sphondylium s. lat. in Europe.. Act. 2e Symp. Intern. Ombellifere (Perpignon) , : 293-303.
CCDB · ita-fl — LOEVE A., LOEVE D. - 1982. IOPB chromosome number reports LXXVI.. Taxon , 31(3): 583-587.
CCDB · ita-fl — BALTISBERGER M. - 1991 (1990). Numeri cromosomici per la flora italiana: 1208-1230.. Inform. Bot. Ital. , 22(3): 216-226.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · brit-fl — Weimarck, G., Stewart, F., Grace, J. Hereditas (Lund) 91: 117-127 (1979)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3311
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3313
CCDB · fl-europaea — Hakansson, 1953
CCDB · poland — Jankun A., Ma?ecka J., Izmai?ow R., Wcis?o H., Czapik R., Musia? K., et al. 1996 Further studies in chromosome numbers of Polish Angiosperms. Part XXV. Acta Biol. Cracov. Ser. Bot. 38, 9-27.
CCDB · poland — Skali?ska M., Ma?ecka J., Izmai?ow R. et al. 1974. Further studies in chromosome numbers of Polish Angiosperms. Tenth contribution. Acta Biol. Cracov. Ser. Bot. 17, 133-163.
CCDB · ipcn-api-dl — Nanushyan, E. R., N. L. Bolsheva, N. S. Badaev & V. N. Tikhomirov. 1985. Differential staining of Heracleum sibiricum L. chromosomes with the help of C-method. Biol. Nauki (Moscow) 5(257): 72–75.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1982. The chromosome numbers of some species of the family Apiaceae. III. Bot. Zhurn. SSSR 67 (2): 206–210. (In Russian).
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1987. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. II. Zapov. Belorussii Issl. 11: 62–69.
CCDB · ipcn-api-dl — Nikolov, N. A. 1991. Chromosome numbers of Bulgarian angiosperms from North Pirin Mountain: Reserve "Bajuvi Dupki--D|3zind|3zirica". Fitologija 41: 70–75.
CCDB · ipcn-api-dl — Dmitrieva, S. A., V. I. Parfenov & I. V. SCHVEC. 1977. The karyological characterization of some species of the Belorussian flora. Vesci Akad. Navuk Belarusk SSR Ser. Bi jal. Sel'skagasp. Navuk. 19: 82–91.
CCDB · ipcn-api-dl — GAGNIDZE, R. J. & P. B. CHKHEIDZE. 1974. The chromosome numbers of some species of Caucasian flora. Soobshch. Akad. Nauk Gruzinsk. SSR 75: 681–684.
CCDB · ipcn-api-dl — Hollingsworth, P. M., R. J. Gornall & J. P. Bailey. 1992. Contribution to a cytological catalogue of the British and Irish flora, 2. Watsonia 19: 134–137.
CCDB · ipcn-api-dl — Tonascia, N. 1992. Biosystematische Untersuchungen an Heracleum sphondylium s.l. in der Schweiz. Ber. Geobot. Inst. ETH Stiftung Rübel 58: 101–120.
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1979. Chromosome numbers of some species of the family Apiaceae Lindl. II. Bot. Zhurn. 64 (2): 227–232.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Skalinska, M. 1974. Further studies in chromosome numbers of Polish angiosperms. X. Acta Biol. Cracov., Ser. Bot. 17: 133–164.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Andreev, V. N. 1979. In IOPB chromosome number reports LXIV. Taxon 28: 397.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Karyological analysis of the species of the flora of eastern Sayana. Pp. 19-48 in L. I. Malyshev & G. A. Peshlcova (eds.) Flora of the Prebaikal. Novosibirsk.
CCDB · ipcn-api-dl — Weimarck, G., F. Stewart & J. Grace. 1979. Morphometric and chromatographic variation and male meiosis in the hybrid Heracleum mantegazzianum X H. sphondylium (Apiaceae) and its parents. Hereditas 91: 117–127.
CCDB · ipcn-api-dl — Murin, A. 1974. In Index of chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Baltisberger, M. 1999. IOPB chromosome data 15. Newslett. Int. Organ. Pl. Biosyst. (Pruhonice) 31: 11–12.
CCDB · ipcn-api-dl — Baltisberger, M. 1990. Numeri cromosomici per la flora Italiana: 1208--1230. Inform. Bot. Ital. 22: 216–226.
CCDB · book-ipcn72 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
CCDB · book-ipcn67-71 — CAUWET, A. - M. 1968. Contriburion a l'etude caryologique des Ombelliferes de la partie orientale des Pyrenees. Naturalia Monspel. Ser. Bot. 19: 5-27.
CCDB · book-ipcn67-71 — KUZMANOV, B., & s. KOZUHAROV. 1969. Chromosome numbers of flowering plants in Bulgaria. 2. Izv. Bot. Inst. (Sofia) 19: 109-115.
+18 more references
2n 241×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Tischler, G. (1950). Die chromosomenzhalen der GefäBpflanzen Mitteleuropas. s'-Gravenhage: W. Junk. 263
n 1114×CCDB · ita-fl · CCDB · iapt · CCDB · iber-fl +6
CCDB · ita-fl — FAVARGER C. - 1973. Cytotaxonomie de quelques Orophytes des Abruzzes.. Acta Bot. Acad. Sci. Hung. , 19(1-4): 81-92.
CCDB · iapt — IAPT/IOPB Chromosome Data 10
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 300-303. Pastor Daz, J.Lagascalia12(2): 279-280(1984).
CCDB · ipcn-api-dl — Rostovtseva, T. S. 1976. Chromosome numbers of some species of the family Apiaceae in South Siberia. Bot. Žhurn. (Moscow & Leningrad) 61(1): 93–99.
CCDB · ipcn-api-dl — Wetschnig, W. & G. H. Leute. 1991. Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457–481.
CCDB · ipcn-api-dl — Weimarck, G., F. Stewart & J. Grace. 1979. Morphometric and chromatographic variation and male meiosis in the hybrid Heracleum mantegazzianum X H. sphondylium (Apiaceae) and its parents. Hereditas 91: 117–127.
CCDB · book-ipcn66 — Bell & Constance 1966
CCDB · book-ipcn67-71 — CAUWET, A. - M. 1968. Contriburion a l'etude caryologique des Ombelliferes de la partie orientale des Pyrenees. Naturalia Monspel. Ser. Bot. 19: 5-27.
CCDB · book-ipcn75-78 — Constance et al. 1976
CCDB · book-ipcn73-74 — FAVARGER, C. 1973. Cytotaxonomie de quelques orophytes des Abruzzes. Acta Bot. Acad. Sci. Hung. 18: 81-92.
CCDB · CromoCat 2015 — Pastor Díaz, J. (1984). Números cromosómicos para la flora española, 300-303. Lagascalia 12(2): 279-280.
CCDB · CromoCat 2015 — Wetschnig, W. & G. H. Leute. (1991). Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457-481.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.7% BUSCO
08Occurrence & distribution
Record type816 218 records
Wild obs. + sensor801 683
Museum / vouchered9 944
Cultivated / captive1 239
Other3 352
Origin
Native53 336
Introduced38
Range
Area of Occupancy AOO523 964 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy43% within 1 km
≤100 m 133 591≤1 km 151 541≤10 km 372 759>10 km 1 270
659 161 georeferenced · 142 522 without coordinates
Open the mapobservation + sensor801 683
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 1 068≤1 km 1 867≤10 km 5 300>10 km 84
8 319 georeferenced · 1 625 without coordinates
Open the institutions mapphysical evidence9 944
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy6% within 1 km
≤1 km 3≤10 km 27>10 km 20
50 georeferenced · 1 189 without coordinates
Open the mapnot free-living1 239
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions81 of 163 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 6 138 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 592 |
| DBF-NHMDlocation not on record | 431 |
| Salzburg, AT | 269 |
| BFLlocation not on record | 266 |
| Uniwersytet Warszawskilocation not on record | 129 |
| LDlocation not on record | 92 |
| Olocation not on record | 88 |
| Karlsruhe, DE | 82 |
| Mlocation not on record | 80 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 78 |
| MeiseBGlocation not on record | 74 |
| Görlitz, DE | 70 |
| Adam Mickiewicz University in Poznańlocation not on record | 50 |
| South Kensington, GB | 45 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 43 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 43 |
| Moscow State Universitylocation not on record | 39 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 35 |
| Bozeman, US | 34 |
| Christchurch, NZ | 31 |
| Bergen, NO | 29 |
| Bern, CH | 27 |
| SLU Artdatabankenlocation not on record | 26 |
| BIO-UNIPIlocation not on record | 25 |
| BRNUlocation not on record | 25 |
| Jyväskylä, FI | 24 |
| Porrentruy, CH | 24 |
| Uniwersytet Śląski w Katowicachlocation not on record | 23 |
| Provincia di Livornolocation not on record | 22 |
| València, ES | 21 |
| TROMlocation not on record | 19 |
| Berlin, DE | 19 |
| Québec, CA | 18 |
| Xiamen, CN | 18 |
| Uniwersytet Opolskilocation not on record | 17 |
| DOI/NPS, Greenbelt Parklocation not on record | 17 |
| Oskarshamn, SE | 16 |
| Turku, FI | 14 |
| MAlocation not on record | 14 |
| Frankfurt am Main | 14 |
| Barcelona, ES | 12 |
| Natural History Museum Rotterdamlocation not on record | 12 |
| Wlocation not on record | 12 |
| College of the Atlantic, Museumlocation not on record | 12 |
| Zürich, CH | 11 |
| BSBIlocation not on record | 10 |
| GJOlocation not on record | 10 |
| Palacký University in Olomouclocation not on record | 10 |
| Kew, GB | 8 |
| Oulu, FI | 8 |
| KMNlocation not on record | 8 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| GZUlocation not on record | 8 |
| Burlington, US | 8 |
| BClocation not on record | 8 |
| Trondheim, NO | 7 |
| Podgorica, ME | 6 |
| Entomological Society of Latvialocation not on record | 6 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 6 |
| Madrid, ES | 5 |
| Acadia Universitylocation not on record | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Uppsala, SE | 5 |
| Paris, FR | 5 |
| LfUlocation not on record | 5 |
| Tilburg, NL | 5 |
| TUR-Alocation not on record | 4 |
| Bronx, US | 4 |
| University of New Hampshirelocation not on record | 4 |
| Saint John, CA | 4 |
| Kuopio, FI | 4 |
| Canberra, AU | 4 |
| Vancouver, CA | 4 |
| Ivano-Frankove, UA | 4 |
| OLAlocation not on record | 4 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| BDBClocation not on record | 3 |
| Spearfish, US | 3 |
| Porvoo, FI | 3 |
| Namur, BE | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 3 |
| SNSNMClocation not on record | 3 |
| Provo, US | 3 |
| Saint Louis, US | 3 |
| SZUlocation not on record | 3 |
| EL PASO, US | 3 |
| Sion, CH | 3 |
| Fulda, DE | 3 |
| New Haven, US | 3 |
| Salamanca, ES | 2 |
| Museo Entomologico de Leonlocation not on record | 2 |
| Hobart, AU | 2 |
| Tartu, EE | 2 |
| Alicante, ES | 2 |
| Columbia, US | 2 |
| Gijón, ES | 2 |
| Wellington, NZ | 2 |
| NMBU:MINAlocation not on record | 2 |
| Appalachian State Universitylocation not on record | 2 |
| Edinburgh, GB | 2 |
| San Angelo, US | 2 |
| Dhaka, BD | 2 |
| Bloomington, US | 2 |
| Zürich, CH | 2 |
| Flagstaff, US | 2 |
| National Museum Waleslocation not on record | 2 |
| Lincoln, US | 2 |
| Frauenfeld, CH | 2 |
| Davenport, US | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| CJBNlocation not on record | 2 |
| Vitoria, ES | 2 |
| Helsinki, FI | 2 |
| IPE-CSIClocation not on record | 1 |
| Logan, US | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Rovaniemi, FI | 1 |
| Universidade Federal de Juiz de Foralocation not on record | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Dekalb, US | 1 |
| Nijmegen, NL | 1 |
| FLADlocation not on record | 1 |
| ROM007location not on record | 1 |
| Fribourg, CH | 1 |
| NTNU University Museum, Department of Natural Historylocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| BGBMlocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Auckland, NZ | 1 |
| Forssa, FI | 1 |
| *unvoucheredlocation not on record | 1 |
| Clemson, US | 1 |
| Albuquerque, US | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Coimbra, PT | 1 |
| Badajoz, ES | 1 |
| B.A. Bennett Herbariumlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| JBCLMlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Bourges, FR | 1 |
| RJBJCIlocation not on record | 1 |
| STUlocation not on record | 1 |
| Glarus, CH | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Tomioka, JP | 1 |
| ESP109location not on record | 1 |
| PRClocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| St. Paul, US | 1 |
| Bangkok, TH | 1 |
| Pamplona, ES | 1 |
| Chapel Hill, US | 1 |
| nbflocation not on record | 1 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 1 |
| Taipei, TW | 1 |
| ISAlocation not on record | 1 |
| Caldwell, US | 1 |
| Chongqing Museumlocation not on record | 1 |
163 institutions · 9 505 of 9 944 vouchered records shown · 418 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA35 detections
Where the DNA of Heracleum sphondylium was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found35
Studies independent surveys1
Countries6
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 35 detections have coordinates
Open the map6 countries0
Roadside with Trifolium repens, Populus bals…Highway roadside in gravels. Disturbed.in semi-natural habitat along river sideDisturbed roadsides with Daucus carota and o…Highway edge in loose gravel.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.2 °C 5.80–17.7
Seasonal swing summer↔winter18.1 °C
Max temp (day)18.2 °C 7.60–21.5
Min temp (night)10.4 °C 2.10–14.0
Precipitation76.7 mm/mo 53.6–110
Air humidity61.4 % 56.3–64.4
Moisture balance-19.0 mm/mo -49.2–42.0
Vapour deficit679 Pa 370–833
Wind speed3.20 m/s 2.20–4.80
Cloud cover50.5 % 39.8–64.5
CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.