Heracleum austriacum

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Apiales/Apiaceae/Heracleum

At a glance

Occurrence records6 354

Data sources8

Biological traits18

DNA specimens5

eDNA detections5

Sources8 archives

Databases and archives Heracleum austriacum's data was compiled from.

GBIFGlobal Biodiversity Information Facility6 354 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements4 literature sources18 traits

Occurrence & distributionGBIF6 354 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

Genome at a glanceCCDB2n = 22

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology5

Plant height0.175 m

Plant height generative0.35 m

Plant height max0.5 m

Plant height min0.3 m

Seed mass5.43 mg

Life cycle & reproduction6

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formherb

⚠ sources differ — GIFT: herb · TRY: herb/non-woody

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typemericarp

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Heracleum austriacum has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes2

GenBank sequences3

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSEU594891.1 ↗602 bpAustria

ACGT

TCGAATCCTGCAGTTGCAGAATGACCCGCTAACATGTAAGTACATTGGTCAAGCGTATGGGGGCTTTGGTCCCCTGTTAGCGAAACCTTG …

Heracleum austriacum subsp. siifolium isolate 1-2 internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcLa★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Heracleum austriacum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode7records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 227×CCDB · fl-europaea · CCDB · book-ipcn65 · CCDB · ipcn-api-dl +2

CCDB · fl-europaea — Polatschek, 1966

CCDB · book-ipcn65 — Favarger 1965a

CCDB · ipcn-api-dl — Krähenbühl, M. & P. Küpfer. 1992. Mediterranean chromosome number reports 2 (92--97). Fl. Medit. 2: 255–258.

CCDB · ipcn-api-dl — Dobea, C. & B. Hahn. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 15–18.

CCDB · book-ipcn66 — Polatschek 1966

CCDB · book-fedorov — Favarger 1965a

CCDB · book-fedorov — Polatschek 1966a

n 111×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Wetschnig, W. & G. H. Leute. 1991. Chromosomenzahlen Kärntner Gefässflanzen (Teil 2, Doldenblütler---Apiaceae = Umbelliferae). Linzer Biol. Beitr. 23: 457–481.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type6 354 records

Wild obs. + sensor6 036

Museum / vouchered224

Other94

Range

Area of Occupancy AOO2 792 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 279≤1 km 4 524≤10 km 652

5 455 georeferenced · 581 without coordinates

Open the mapobservation + sensor6 036

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 10≤1 km 46≤10 km 128

184 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence224

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salzburg, AT	83
GJOlocation not on record	63
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	17
LDlocation not on record	12
Provincia di Livornolocation not on record	8
GZUlocation not on record	7
Oskarshamn, SE	6
Wlocation not on record	6
University of Salzburglocation not on record	4
SZUlocation not on record	4
Herb. BBGlocation not on record	3
Mlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Bern, CH	2
Sion, CH	1
Moscow State Universitylocation not on record	1
BRNUlocation not on record	1
Berlin, DE	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1

19 institutions · 224 of 224 vouchered records shown

09Environmental DNA5 detections

Where the DNA of Heracleum austriacum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

dry to semidry natural montane grassland (!)…open montane complex of fragmentary spruce/l…along road and river (dolomite area)subalpine calcareous grassland and scrubland…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.1 °C 10.1–14.2

Seasonal swing summer↔winter19.0 °C

Max temp (day)16.5 °C 14.7–18.5

Min temp (night)6.90 °C 4.70–9.50

Precipitation232 mm/mo 184–341

Air humidity64.6 % 62.6–65.2

Moisture balance115 mm/mo 73.9–234

Vapour deficit502 Pa 435–613

Wind speed3.80 m/s 3.40–4.50

Cloud cover34.8 % 34.3–35.7

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Heracleum austriacum

At a glance

Sources8 archives

Size & morphology5

Life cycle & reproduction6

Diet & foraging1

Habitat & environment4

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 354 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 354 records