Hepsetus cuvieri

(Castelnau, 1861) · species

image placeholder — illustration coming later

Animalia/Chordata/Characiformes/Hepsetidae/Hepsetus

At a glance

Occurrence records261

Data sources9

Biological traits5

DNA specimens6

eDNA detections2

Sources9 archives

Databases and archives Hepsetus cuvieri's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility261 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF261 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD6 specimens

01Narrative

Hepsetus cuvieri, sometimes known as the African pike or Kafue pike characin, is a predatory freshwater fish found in southern Africa. This species was described in 1861 by the French naturalist Francis de Laporte de Castelnau. The fish is named in honor of Georges Cuvier (1769-1832).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length37 cm

Life cycle & reproduction1

Max. longevity60 months

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

Other traits1

Vulnerability35.14

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hepsetus cuvieri has left across the world's sequence archives.

At a glance

DNA specimens6

BINs3

Marker genes1

eDNA detections2

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P613 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 36 variable positions, in barcode order

6Cvariable

17Cmostly conserved

23Cmostly conserved

24Gvariable

36Gmostly conserved

40Amostly conserved

46Cvariable

58Tmostly conserved

65Cmostly conserved

86Amostly conserved

118Avariable

124Amostly conserved

176Gmostly conserved

274Gvariable

280Gvariable

298Cvariable

316Cmostly conserved

320Gmostly conserved

328Amostly conserved

337Cmostly conserved

350Amostly conserved

358Avariable

375Tmostly conserved

418Tvariable

451Gvariable

476Tmostly conserved

531Cmostly conserved

554Tmostly conserved

564Cmostly conserved

568Cmostly conserved

571Cmostly conserved

583Gmostly conserved

590Gmostly conserved

603Amostly conserved

607Amostly conserved

608Cmostly conserved

CACCGCTCTCAGCCTCCTAATCCGAGCAGAACTCAGCCAACCAGGCTCCCTCCTGGGTGACGACCAGATTTACAATGTTATTGTTACCGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes6

BINs3

Most divergent pair4.4%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hepsetus microlepissame genus7.7%Hepsetus lineatussame genus11.9%Hepsetus occidentalissame genus12.6%Hepsetus odoesame genus14.2%Hepsetus kingsleyaesame genus14.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type261 records

Wild obs. + sensor129

Museum / vouchered132

Origin

Native17

Range

Area of Occupancy AOO216 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 125≤1 km 1

126 georeferenced · 3 without coordinates

Open the mapobservation + sensor129

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 76≤1 km 21

97 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence132

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brussels, BE	97
South African Institute for Aquatic Biodiversitylocation not on record	16
Royal Museum for Central Africalocation not on record	15
Stockholm, SE	3
Texas Cooperative Wildlife Collectionlocation not on record	1

5 institutions · 132 of 132 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Hepsetus cuvieri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)