Hepatus pudibundus

(Herbst, 1785) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Aethridae/Hepatus

At a glance

Occurrence records598

Data sources8

Biological traits4

DNA specimens3

eDNA detections4

Sources8 archives

Databases and archives Hepatus pudibundus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility391 records↗

OBISOcean Biodiversity Information System207 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS598 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD3 specimens

01Narrative

Hepatus pudibundus, the flecked box crab, is a crab from the class Malacostraca. They are found in the Atlantic Ocean with Brazil having a dense population of H.pudibundus, as they are one of the most commonly seen crabs in the country. Many of the studies done on H.pudibubus have occurred in the Ubatuba region of Brazil, where there is a rapid expansion of tourism that is affecting marine ecosystems.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length8.15 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits1

Depth max160 m

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hepatus pudibundus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P624 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.27%

Haplotypes2

BIN1

Most divergent pair0.32%

Where individuals differ — all 2 variable positions, in barcode order

597Cvariable

624Cvariable

GGGACCTCTTTAAGTCTTATTATCCGTGCTGAATTAAGTCAGCCAGGAACCCTTATTGGAAATGATCAAATTTATAATGTAATTGTTACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pilodius miersisame order14.5%Pilodius granulatussame order15.0%Matuta planipessame order15.2%Chlorodiella nigrasame order15.3%Chlorodiella spinimerasame order15.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type598 records

Wild obs. + sensor95

Museum / vouchered387

Cultivated / captive8

Other108

Origin

Native1

Range

Area of Occupancy AOO1 324 km²

Depth

0–200 m sunlit46

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 20 m · max 81 m · 46 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy43% within 1 km

≤100 m 5≤1 km 5≤10 km 3>10 km 10

23 georeferenced · 72 without coordinates

Open the mapobservation + sensor95

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 1≤10 km 3

4 georeferenced · 383 without coordinates

Open the institutions mapphysical evidence387

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	53
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	41
PUC-RSlocation not on record	32
Masindi, UG	27
Paris, FR	19
Instituto de Investigaciones Marinas y Costeras José Benito Vives de Andreis - Invemarlocation not on record	9
UM-RSMASlocation not on record	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	4
Montgomery, US	3
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	3
Museu Paraense Emílio Goeldilocation not on record	2
Museum für Naturkunde Berlin (Zoological Collections)location not on record	2
New Haven, US	1
Buenos Aires, AR	1
FCMMlocation not on record	1
Sistema de Colecciones Biológicas, Escuela de Biología, Universidad de San Carlos de Guatemala location not on record	1
Porto Alegre, BR	1
Texas Cooperative Wildlife Collectionlocation not on record	1

18 institutions · 208 of 387 vouchered records shown · 24 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Hepatus pudibundus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Verifiable raw sequence linked4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.0 °C 23.0–23.0

Seasonal swing summer↔winter6.10 °C

Max temp (day)23.9 °C

Min temp (night)22.2 °C

Precipitation60.4 mm/mo

Air humidity59.4 %

Vapour deficit1,134 Pa

Cloud cover32.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)