Hepatus epheliticus

(Linnaeus, 1763) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Aethridae/Hepatus

At a glance

Occurrence records2 915

Data sources8

Biological traits4

DNA specimens10

eDNA detections0

Sources8 archives

Databases and archives Hepatus epheliticus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 625 records↗

OBISOcean Biodiversity Information System1 290 records↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~1.70 Gbp↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS2 915 records

DNA & barcodingBOLD10 specimens

Genome at a glanceGoaT1.7 Gbp

01Narrative

Hepatus epheliticus, known by various names, including the calico crab (not to be confused with Ovalipes ocellatus) and Dolly Varden crab, is a species of crab. It lives in shallow water in the western Atlantic Ocean from the Chesapeake Bay to the Dominican Republic. It has a 3 in–wide carapace adorned with large red spots with darker outlines.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max91 m

Depth min2 m

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hepatus epheliticus has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

169Gmostly conserved

214Gmostly conserved

226Cmostly conserved

244Avariable

301Amostly conserved

325Gmostly conserved

337Amostly conserved

340Tvariable

373Gvariable

421Gmostly conserved

455Gmostly conserved

469Amostly conserved

616Cvariable

622Amostly conserved

631Avariable

637Cmostly conserved

641Tvariable

643Amostly conserved

TACACTATATTTTATTTTTGGTGCATGATCAGGAATAGTAGGGACCTCTTTAAGTCTTATTATCCGTGCTGAATTAAGTCAGCCAGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes4

BIN1

Most divergent pair1.8%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Pilodius miersisame order13.9%Actaea spinosissimasame order14.9%Pilodius granulatussame order15.0%Chlorodiella nigrasame order15.1%Chlorodiella spinimerasame order15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Hepatus epheliticus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 701 720 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Hepatus epheliticus1.7 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type2 915 records

Wild obs. + sensor2 100

Museum / vouchered812

Fossil3

Origin

Native33

Range

Area of Occupancy AOO5 064 km²

Depth

0–200 m sunlit1 210

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 8 m · max 95.1 m · 1 210 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 590≤1 km 174≤10 km 108>10 km 52

924 georeferenced · 1 176 without coordinates

Open the mapobservation + sensor2 100

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 32≤1 km 14≤10 km 7>10 km 7

60 georeferenced · 752 without coordinates

Open the institutions mapphysical evidence812

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	143
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	35
Texas Cooperative Wildlife Collectionlocation not on record	33
Mexico City, MX	28
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	28
San Nicolás de los Garza, MX	15
Cambridge, US	12
	12
FCMMlocation not on record	7
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	7
UM-RSMASlocation not on record	6
Alabama Museum of Natural Historylocation not on record	5
Instituto Oceanográfico del Pacífico, Secretaría de Marinalocation not on record	4
Santa Barbara Museum of Natural Historylocation not on record	3
Centro de Investigación y de Estudios Avanzados, Unidad Irapuato, Instituto Politécnico Nacionallocation not on record	3
Chicago, US	3
Montgomery, US	2
Toronto, CA	2
New Haven, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
CASlocation not on record	1

21 institutions · 351 of 812 vouchered records shown · 195 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Hepatus epheliticus

At a glance

Sources8 archives

Habitat & environment2

Other traits2

At a glance

Genome sizehow big the whole instruction manual is

Record type2 915 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 21 geolocated

Record type2 915 records