Hepatica transsilvanica

Fuss · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Hepatica

At a glance

Occurrence records413

Data sources10

Biological traits3

DNA specimens0

eDNA detections4

Sources10 archives

Databases and archives Hepatica transsilvanica's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility413 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources3 traits

Occurrence & distributionGBIF413 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingNCBIsequences

Genome at a glanceCCDB · GoaT29.5 Gbp

01Narrative

Hepatica transsilvanica, called the large blue hepatica, is a species of flowering plant in the genus Hepatica, native to the Carpathian Mountains of Romania. It has gained the Royal Horticultural Society's Award of Garden Merit.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction1

Life formperennial

Habitat & environment2

Climatetemperate

Woodinessnon-woody

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hepatica transsilvanica has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

eDNA detections4

Countries2

The DNA barcodea real sequence read deposited for this species

ITSMK550971.1 ↗573 bpRomania

ACGT

TCGATACCTGCTCAGCAGAACGACCCGCGAACACGTGAAAACAACCACACGCCGGGGCACATGGCGTGGCAACCTCGTCGTTGCCTCCGA …

Hepatica transsilvanica isolate HT1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL4★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Hepatica transsilvanica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size29 511 150 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Hepatica transsilvanica29.51 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidy4× tetraploid · measured

Chromosome records16–322n range28median28mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 283×GoaT · Kew Plant DNA C-values Database · CCDB · fl-europaea · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · fl-europaea — Baumberger, 1970

CCDB · kew — Mabuchi T, Kokubun H, Mii M, Ando T. 2005. Nuclear DNA content in the genus Hepatica (Ranunculaceae). Journal of Plant Research 118: 37-41.

2n 161×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants

2n 321×CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Rosenthal 1936

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type413 records

Wild obs. + sensor377

Museum / vouchered36

Range

Area of Occupancy AOO532 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 258≤1 km 47≤10 km 25>10 km 9

339 georeferenced · 38 without coordinates

Open the mapobservation + sensor377

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 11≤10 km 1>10 km 2

14 georeferenced · 22 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	10
Oskarshamn, SE	5
Institut und Museum fuer Geologie und Palaeontologielocation not on record	4
BClocation not on record	2
LDlocation not on record	2
BFLlocation not on record	2
ROM020location not on record	1
Auckland, NZ	1
DBF-NHMDlocation not on record	1
Uppsala, SE	1
Berlin, DE	1
inatura Erlebnis Naturschau GmbHlocation not on record	1
Dresden, DE	1
BRNUlocation not on record	1
Wellington, NZ	1
Stockholm, SE	1

16 institutions · 35 of 36 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Hepatica transsilvanica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.60 °C 7.10–8.20

Seasonal swing summer↔winter20.7 °C

Max temp (day)11.9 °C 11.3–12.5

Min temp (night)2.80 °C 2.30–3.40

Precipitation114 mm/mo 68.8–159

Air humidity62.5 % 61.3–63.7

Moisture balance45.1 mm/mo 1.30–89.0

Vapour deficit447 Pa 412–483

Wind speed2.40 m/s 2.20–2.60

Cloud cover45.7 % 45.1–46.4

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)