Hepatica nobilis
Schreb. · speciesAt a glance
Occurrence records253 317
Data sources11
Biological traits42
DNA specimens27
eDNA detections15
Sources11 archives
Databases and archives Hepatica nobilis's data was compiled from.
WikipediaWikimedia Foundation12 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility253 317 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics27 specimens↗
NCBIUS National Library of Medicinesequences↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources42 traits
Occurrence & distributionGBIF253 317 records
Environmental DNA1 datasets · 5 countries15 detections
DNA & barcodingBOLD · NCBI27 specimens
Genome at a glanceCCDB · GoaT16.2 Gbp
01Narrative
Anemone hepatica (syn. Hepatica nobilis), the common hepatica, liverwort, kidneywort, or pennywort, is a species of flowering plant in the buttercup family Ranunculaceae, native to woodland in temperate regions of the Northern Hemisphere. This herbaceous perennial grows from a rhizome.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology13
Fruit length4 mm
Fruit length max4 mm
Fruit length min4 mm
Leaf mass109 mg
Leaf size2 888 mm²
Plant height0.095 m
⚠ sources differ — GIFT: 0.095 m · LEDA: 0.095 m · TRY: 0.086 m
Plant height generative0.129 m
Plant height max0.15 m
Plant height min0.05 m
Seed length4.5 mm
Seed mass3.24 mg
⚠ sources differ — TRY: 3.24 mg · LEDA: 2.32 mg · GIFT: 2.65 mg
Seed mass max3.7 mg
Seed mass min2.27 mg
Life cycle & reproduction12
Deciduousnessevergreen
Dispersal typeblastochor
⚠ sources differ — LEDA: blastochor · GIFT: zoochorous
Flowering endMay
Flowering startApr
Life formperennial
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial
Lifespan years3 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Seed number120
Self fertilizationabsent
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest, meadows, shrubberies
Mycorrhiza type0.0000000592
Woodinessnon-woody
Physiology & chemistry7
Leaf c439 mg/g
Leaf dry-matter content (LDMC)234 mg/g
⚠ sources differ — TRY: 234 mg/g · LEDA: 186 mg/g
Leaf n18.04 mg/g
Leaf p2.1 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)18.38 mm²/mg
⚠ sources differ — TRY: 18.38 mm²/mg · LEDA: 27.16 mm²/mg · GIFT: 27.16 mm²/mg
Other traits1
Diaspore typefruitlet
05DNA & barcoding27 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hepatica nobilis has left across the world's sequence archives.
At a glance
DNA specimens27
Marker genes6
GenBank sequences10
eDNA detections15
Countries7
The DNA barcodea real sequence read deposited for this species
TGTCTCGTTACCGAGGGCCTCGTTTCAAAAAAATACGCCGTCTGGGTGTTTTACCGGGACTAACTAGCCAATTTAAAATGCTCAGATGTA …
Hepatica nobilis chloroplast, complete genome
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK6★rbcL4★rbcLa★ITS★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Hepatica nobilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size16 239 201 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Hepatica nobilis16.24 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–422n range14median14mode80records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1475×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +20
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — TORNADORE N., POPOVA M., GARBARI F. - 1974. Numeri cromosomici per la flora italiana:172-181.. Inform. Bot. Ital. , 6(1): 43-54.
CCDB · ita-fl — PERUZZI L., CESCA G. - 2003. Reports 1348-1356. In: Kamari G., Blanch C., Garbari F. (Eds.). Mediterranean chromosome number reports 13. Flora Medit. , 13: 373-382.
CCDB · slov-fl — Uhríková A. & Králik E., 2000: Karyologické štúdium slovenskej flóry XXIX. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 17-22.
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iber-fl — Cytotaxomy of spanish plants. III.-Dicotyledons Lve, A. & E. Kjellqvist.Lagascalia4(1): 3-32(1974).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1620
CCDB · fl-europaea — Skalinska et al.
CCDB · poland — Skali?ska M., Czapik R., Piotrowicz M. et al. 1959. Further studies in chromosome numbers of Polish Angiosperms (Dicotyledons). Acta Soc. Bot. Pol. 28, 487-529.
CCDB · book-ipcn65 — Kawano 1965
CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. In: IOPB chromosome number reports LXXIV. Taxon 31: 120–126.
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · ipcn-api-dl — Okada, H. & M. TAMURA. 1979. Karyomorphology and relationship in the Ranunculaceae. J. Jap. Bot. 54: 65–77.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — `opova, M. & Ž. Sekovski. 1989. Chromosome atlas of some Macedonian angiosperms. V. God. Zborn. Biol. Prir.-Mat. Fak. Univ. Kiril & Metodij 39–40: 353–365.
CCDB · ipcn-api-dl — Semerenko, L. V. 1990. Chromosome numbers of some flowering plants from the Berezinsky Biosphere Reservation (the Byelorussian Soviet Socialist Republic). Bot. Žhurn. (Moscow & Leningrad) 75: 279–282.
CCDB · ipcn-api-dl — Druskovic, B. & M. Lovka. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 15–19.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — MARKS, G. E. & D. Schweizer. 1974. Giemsa banding: karyotype differences in some species of Anemone and in Hepatica nobilis. Chromosoma 44: 405–416.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 2002. Chromosome numbers of Ranunculaceae species of the Byelorussian flora. Bot. Žhurn. (Moscow & Leningrad) 87(11): 131–133.
CCDB · ipcn-api-dl — Peruzzi, L. & G. Cesca. 2003. Mediterranean chromosome number reports 13 (1348--1356). Fl. Medit. 13: 373–382.
CCDB · ipcn-api-dl — Wcislo, H. 1987. Chromosome numbers of certain Canadian plants. Acta Biol. Cracov., Ser. Bot. 29: 19–30.
CCDB · ipcn-api-dl — Mabuchi, T. 1998. Comparative morphology and mitotic behavior of B chromosome in Hepatica americana, H. acutiloba and H. nobilis. Chromosome Sci. 2: 27–29.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1988. Chromosome numbers in vascular plants from Primorye Territory, the Amur River basin, north Koryakia, Kamchatka and Sakhalin. Bot. Žhurn. (Moscow & Leningrad) 73: 290–293.
CCDB · ipcn-api-dl — Weiss, H., B. y. Sun, T. F. Stuessy, C. H. Kim, H. Kato & M. Wakabayashi. 2002. Karyology of plant species endemic to Ullung Island (Korea) and selected relatives in peninsular Korea and Japan. Bot. J. Linn. Soc. 138(1): 93–105.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-ipcn72 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
CCDB · book-ipcn72 — SUSNIK, F., B. DRUSKOVIC, A. LOEVE & D. LOEVE. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 31-346.
CCDB · book-ipcn67-71 — BAUMBERGER, H. 1970. Chromosomenzahlbestimmungen und Karyotypanalysen bei den Gattungen Anemone, Hepatica und Pulsatilla. Ber. Schweiz. Bot. Ges. 80: 17-96.
CCDB · book-ipcn67-71 — BOCHANTZEVA, V.V. 1971. Chromosome numbers of certain Ranunculaceae of the Leningrad region. Bot. Zurn. (Moscow & Leningrad) 56: 684.
CCDB · book-ipcn67-71 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797:-
CCDB · book-ipcn67-71 — KURITA, M. 1957. Chromosome studies in Ranunculaceae I. Karyotypes of the subtribe Anemoninae. Rep. Biol. Inst. Ehime Univ. 1: 1-10.
CCDB · book-ipcn75-78 — Tornadore et al. 1974
CCDB · book-ipcn73-74 — CHUPOV, V.S. 1974. The materials on the geography of chromosome numbers in genera Anemone L., Pulsatilla Mill. and Hepatica Mill. Cidl Russian) Bot zurn. (Moscow & Leningrad) 59: 398-406. . I
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1974. Cytotaxonomy of Spanish plants. III Dicotyledons: Salicaceae - Rosaceae. Lagascalia 4: 3-32.
CCDB · eflora
CCDB · book-fedorov — Langlet 1932
CCDB · book-atlas-flowering-plants — Langlet 1932
+23 more references
2n 284×CCDB · book-ipcn67-71 · CCDB · book-atlas-flowering-plants · CCDB · kew +1
CCDB · book-ipcn67-71 — KURITA, M. 1957. Chromosome studies in Ranunculaceae I. Karyotypes of the subtribe Anemoninae. Rep. Biol. Inst. Ehime Univ. 1: 1-10.
CCDB · book-atlas-flowering-plants — Langlet 1927a
CCDB · kew — Mabuchi T, Kokubun H, Mii M, Ando T. 2005. Nuclear DNA content in the genus Hepatica (Ranunculaceae). Journal of Plant Research 118: 37-41.
CCDB · Cave1957 — Hiroe
2n 421×CCDB · Cave1957
CCDB · Cave1957 — Hiroe
n 71×CCDB · book-ipcn65
CCDB · book-ipcn65 — Laane 1965
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type253 317 records
Wild obs. + sensor240 280
Museum / vouchered12 550
Cultivated / captive108
Other379
Origin
Native755
Introduced47
Range
Area of Occupancy AOO240 312 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy79% within 1 km
≤100 m 115 066≤1 km 47 826≤10 km 36 860>10 km 6 933
206 685 georeferenced · 33 595 without coordinates
Open the mapobservation + sensor240 280
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy38% within 1 km
≤100 m 1 016≤1 km 2 765≤10 km 4 930>10 km 1 166
9 877 georeferenced · 2 673 without coordinates
Open the institutions mapphysical evidence12 550
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 31>10 km 11
42 georeferenced · 66 without coordinates
Open the mapnot free-living108
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions62 of 138 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 409 |
| Helsinki, FI | 953 |
| Olocation not on record | 896 |
| BFLlocation not on record | 725 |
| LDlocation not on record | 553 |
| Trondheim, NO | 387 |
| BIO-UNIPIlocation not on record | 291 |
| KMNlocation not on record | 258 |
| Salzburg, AT | 257 |
| Oskarshamn, SE | 232 |
| SLU Artdatabankenlocation not on record | 196 |
| Moscow State Universitylocation not on record | 180 |
| Turku, FI | 161 |
| Oulu, FI | 123 |
| Tartu, EE | 122 |
| Kuopio, FI | 117 |
| Jyväskylä, FI | 74 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 74 |
| Bergen, NO | 70 |
| Tampere, FI | 70 |
| València, ES | 69 |
| Bern, CH | 69 |
| Provincia di Livornolocation not on record | 68 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 59 |
| MAlocation not on record | 54 |
| Tallinn, EE | 43 |
| Zürich, CH | 42 |
| Görlitz, DE | 40 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 39 |
| Zürich, CH | 36 |
| Porvoo, FI | 36 |
| GJOlocation not on record | 34 |
| LfUlocation not on record | 32 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 31 |
| BClocation not on record | 30 |
| TROMlocation not on record | 29 |
| BRNUlocation not on record | 28 |
| TUR-Alocation not on record | 25 |
| Entomological Society of Latvialocation not on record | 23 |
| Mlocation not on record | 22 |
| Uniwersytet Śląski w Katowicachlocation not on record | 20 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 19 |
| College of the Atlantic, Museumlocation not on record | 18 |
| No collectionlocation not on record | 18 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 18 |
| GZUlocation not on record | 16 |
| Karlsruhe, DE | 13 |
| SZUlocation not on record | 13 |
| Madrid, ES | 12 |
| Wlocation not on record | 12 |
| Porrentruy, CH | 12 |
| Saint John, CA | 11 |
| CICYTEXlocation not on record | 11 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 11 |
| CJBGlocation not on record | 10 |
| Frauenfeld, CH | 10 |
| NMBU:MINAlocation not on record | 9 |
| Pamplona, ES | 8 |
| Berlin, DE | 8 |
| Forssa, FI | 8 |
| Auckland, NZ | 7 |
| Uniwersytet Jagiellońskilocation not on record | 6 |
| Frankfurt am Main | 5 |
| University of Gdansk, Dept. of Plant Taxonomy & Nature Conservationlocation not on record | 5 |
| Stockholm, SE | 5 |
| Sion, CH | 5 |
| Tromso University Museumlocation not on record | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Glarus, CH | 4 |
| UoB-IBlocation not on record | 3 |
| Philadelphia, US | 3 |
| Uppsala, SE | 3 |
| PRClocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Chicago, US | 3 |
| Salamanca, ES | 3 |
| Rovaniemi, FI | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| China Agricultural Universitylocation not on record | 3 |
| New Haven, US | 3 |
| Tula State Universitylocation not on record | 3 |
| DBF-NHMDlocation not on record | 3 |
| Fulda, DE | 3 |
| New Brunswick, US | 3 |
| Dekalb, US | 2 |
| nbflocation not on record | 2 |
| München, DE | 2 |
| ISAlocation not on record | 2 |
| Pamplona, ES | 2 |
| AUT001location not on record | 2 |
| H-Wolflocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Mohonk Preservelocation not on record | 2 |
| Ivano-Frankove, UA | 2 |
| Dresden, DE | 2 |
| Bourges, FR | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Paris, FR | 2 |
| Granada, ES | 2 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 2 |
| University of Stellenboschlocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Minia, EG | 1 |
| Whitewater, US | 1 |
| PrivatHerblocation not on record | 1 |
| SWlocation not on record | 1 |
| Philadelphia, US | 1 |
| H-Schuhwlocation not on record | 1 |
| Miami, US | 1 |
| Jaén, ES | 1 |
| Montréal, CA | 1 |
| Badajoz, ES | 1 |
| AUAlocation not on record | 1 |
| Sevilla, ES | 1 |
| San Angelo, US | 1 |
| ULBF-AGRlocation not on record | 1 |
| OLAlocation not on record | 1 |
| Mississippi State, US | 1 |
| Uniwersytet Warszawskilocation not on record | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| Boumlocation not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| FLADlocation not on record | 1 |
| Dhaka, BD | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| University of Southern Mississippilocation not on record | 1 |
| Banyoles, ES | 1 |
| Herb. BBGlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| EL PASO, US | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Göteborg, SE | 1 |
| Umeå Universitylocation not on record | 1 |
138 institutions · 12 376 of 12 550 vouchered records shown · 170 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA15 detections
Where the DNA of Hepatica nobilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found15
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 15 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median8.30 °C 3.20–10.9
Seasonal swing summer↔winter19.8 °C
Max temp (day)12.7 °C 4.10–14.9
Min temp (night)3.50 °C -0.9–7.70
Precipitation83.7 mm/mo 55.8–170
Air humidity62.1 % 60.2–64.1
Moisture balance10.1 mm/mo -42.0–100
Vapour deficit492 Pa 280–571
Wind speed2.60 m/s 2.10–4.00
Cloud cover44.9 % 31.5–63.9
CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.