Henricus fuscodorsana

(Kearfott, 1904) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Henricus

At a glance

Occurrence records28

Data sources8

Biological traits0

DNA specimens16

eDNA detections15

Sources8 archives

Databases and archives Henricus fuscodorsana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF28 records

Environmental DNA1 datasets · 2 countries15 detections

DNA & barcodingBOLD16 specimens

01Narrative

Henricus fuscodorsana, the cone cochylid moth, is a species of moth of the family Tortricidae. It is found in North America, where it has been recorded from Arizona, British Columbia, California, Colorado, Idaho, Oregon and Washington.mothphotographersgroup The wingspan is 17–18 mm. Adults have been recorded on wing from April to October. The larvae mine the cones of Picea species (including Picea pungens),Cone and Seed Insects of Western Forest Trees as well as Pseudotsuga, Sequoia, Abies and Larix species. They are reddish green.Western Forest Insects

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Henricus fuscodorsana has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections15

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

220Cmostly conserved

226Cmostly conserved

229Gmostly conserved

316Amostly conserved

373Tmostly conserved

382Cmostly conserved

409Gmostly conserved

433Gmostly conserved

477Gmostly conserved

562Amostly conserved

577Gmostly conserved

578Tmostly conserved

628Amostly conserved

653Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCTTTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.44%

Haplotypes5

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Henricus macrocarpanasame genus8.4%Eupinivora ponderosaesame family8.5%Phtheochroa baracanasame family8.8%Phtheochroa riscanasame family8.8%Phtheochroa birdanasame family8.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type28 records

Wild obs. + sensor16

Museum / vouchered12

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 7≤1 km 3≤10 km 1

11 georeferenced · 5 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 8

8 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence12

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Colorado State Universitylocation not on record	4
Denver, US	2
San Francisco, US	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Washington State Department of Agriculturelocation not on record	1

5 institutions · 10 of 12 vouchered records shown · 2 without an institution code

09Environmental DNA15 detections

Where the DNA of Henricus fuscodorsana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 11.2–16.0

Seasonal swing summer↔winter15.9 °C

Max temp (day)20.1 °C 15.9–22.4

Min temp (night)11.0 °C 5.10–13.2

Precipitation83.8 mm/mo 35.4–133

Air humidity60.9 % 51.5–63.7

Moisture balance-33.0 mm/mo -106–51.8

Vapour deficit673 Pa 587–832

Wind speed2.00 m/s 1.40–4.10

Cloud cover39.4 % 28.1–44.0

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)