Henonia scoparia

Moq. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Caryophyllales/Amaranthaceae/Henonia

At a glance

Occurrence records56

Data sources7

Biological traits9

DNA specimens1

eDNA detections1

Sources7 archives

Databases and archives Henonia scoparia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources9 traits

Occurrence & distributionGBIF56 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Henonia is een geslacht uit de amarantenfamilie (Amaranthaceae). Het geslacht telt een soort die voorkomt op Madagaskar. Het geslacht is vernoemd naar Jacques-Louis Hénon, een Frans arts, botanicus en politicus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass0.529 mg

Life cycle & reproduction2

Life formtree

Life spanperennial

Habitat & environment5

Aquaticterrestrial

Climateseasonally dry tropical

Epiphyteterrestrial

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Henonia scoparia has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSLT995160.1 ↗692 bpMadagascar

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCAGCGAACATGTTTATATCATGCATGGGGCGGGG …

Henonia scoparia 18S rRNA gene (partial), ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene (partial), isolate AC0905

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type56 records

Wild obs. + sensor7

Museum / vouchered49

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 7

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 48 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Plocation not on record	12
Saint Louis, US	9
Paris, FR	4
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	4
Kew, GB	3
Glocation not on record	2
CJBGlocation not on record	1
Llocation not on record	1
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
University of Stellenboschlocation not on record	1
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	1
WAGlocation not on record	1

12 institutions · 40 of 49 vouchered records shown · 9 without an institution code

09Environmental DNA1 detections

Where the DNA of Henonia scoparia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)