Hemipristis elongata

(Klunzinger, 1871) · species

image placeholder — illustration coming later

Animalia/Chordata/Elasmobranchii/Carcharhiniformes/Hemigaleidae/Hemipristis

At a glance

Occurrence records352

Data sources11

Biological traits7

DNA specimens69

eDNA detections72

Sources11 archives

Databases and archives Hemipristis elongata's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility177 records↗

OBISOcean Biodiversity Information System175 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI72 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics69 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Paleobiology DatabasePBDB consortiumfossil record↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS352 records

Environmental DNA1 datasets · 8 countries72 detections

DNA & barcodingBOLD69 specimens

01Narrative

The snaggletooth shark, or fossil shark (Hemipristis elongata), is a species of weasel shark in the family Hemigaleidae, and the only extant member of the genus Hemipristis. It is found in the Indo-West Pacific, including the Red Sea, from southeast Africa to the Philippines, north to China, and south to Australia, at depths from 1 to 130 metres. This shark can be found near the bottom of the water column of coastal areas, but can be found at continental and insular shelves. Its length is up to 240 cm (7.87 ft) . Despite being only vulnerable to extinction, this shark is very rarely seen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length240 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonedemersal

Uses & economy1

Commercial importancecommercial

Other traits3

Depth max130 m

Depth min1 m

Vulnerability90

05DNA & barcoding69 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Hemipristis elongata has left across the world's sequence archives.

At a glance

DNA specimens69

BINs1

Marker genes1

eDNA detections72

Countries11

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus68 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

76Gmostly conserved

413Gmostly conserved

547Cvariable

CCTTTATCTGATTTTTGGTGCATGAGCAGGAATAGTTGGAACAGCCCTGAGTCTTTTAATTCGAGCTGAATTAGGGCAACCAGGTTCTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes8

BIN1

Most divergent pair1.1%

AsiaOceaniaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Carcharhinus galapagensissame order10.7%Carcharhinus acronotussame order11.1%Carcharhinus leucassame order11.2%Glyphis garrickisame order11.2%Carcharhinus altimussame order11.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_032065 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND1ND2COX1COX2ATP8ATP6COX3ND3ND4LND4ND5ND6CYTB12S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type352 records

Wild obs. + sensor217

Museum / vouchered135

Origin

Native2

Range

Area of Occupancy AOO612 km²

Depth

0–200 m sunlit69

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 37.5 m · max 144 m · 69 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 33≤1 km 130≤10 km 2>10 km 18

183 georeferenced · 34 without coordinates

Open the mapobservation + sensor217

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 9≤1 km 21≤10 km 37>10 km 5

72 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence135

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DEWlocation not on record	15
Australian National Fish Collectionlocation not on record	12
Sydney, AU	5
Natick, US	4
Museum and Art Gallery of the Northern Territorylocation not on record	4
CASlocation not on record	3
Western Australian Museumlocation not on record	3
Los Angeles, US	2
	2
SEAOBISlocation not on record	1
Kagoshima University Museumlocation not on record	1
CSIRO, Australian National Fish Collectionlocation not on record	1
South African Institute for Aquatic Biodiversitylocation not on record	1
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	1

14 institutions · 55 of 135 vouchered records shown · 11 without an institution code

09Environmental DNA72 detections

Where the DNA of Hemipristis elongata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found72

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 72 detections have coordinates

Open the map8 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 24.7–35.7

Seasonal swing summer↔winter3.50 °C

Max temp (day)29.8 °C 26.1–43.1

Min temp (night)22.3 °C 19.3–29.2

Precipitation109 mm/mo 0.5–343

Air humidity61.7 % 48.9–69.6

Moisture balance-17.8 mm/mo

Vapour deficit1,221 Pa 1,012–2,957

Wind speed3.40 m/s

Cloud cover26.5 % 3.70–58.5

CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)