Helvella albella — The Life Data

Fungi/Ascomycota/Pezizomycetes/Pezizales/Helvellaceae/Helvella

At a glance

Occurrence records182

Data sources9

Biological traits0

DNA specimens4

eDNA detections3

Sources9 archives

Databases and archives Helvella albella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility182 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF182 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

01Narrative

Helvella albella is a species of fungi in the family Helvellaceae that is found in Europe and North America. It was described by French mycologist Lucien Quélet in 1896.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Helvella albella has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences9

eDNA detections3

Countries4

The DNA barcodea real sequence read deposited for this species

ITSKT875007.1 ↗517 bpMexico · 2009

ACGT

AAGGATCATTACAGAGTTCATGCCCTTCGGGGTAGACCTCCACCCTTGCATACCTTACCTTTGTTGCTTTGGCGGCCCGCCTCACCTTGT …

Helvella albella voucher AR09698 partial 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and partial 25S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS9ITS1

fungal barcode

08Occurrence & distribution

Record type182 records

Wild obs. + sensor45

Museum / vouchered135

Other2

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 5≤1 km 9≤10 km 14>10 km 1

29 georeferenced · 16 without coordinates

Open the mapobservation + sensor45

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 6≤1 km 13≤10 km 19>10 km 5

43 georeferenced · 92 without coordinates

Open the institutions mapphysical evidence135

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uppsala, SE	11
Ann Arbor, US	9
Copenhagen, DK	9
	8
LDlocation not on record	8
Karlsruhe, DE	7
WU-MYClocation not on record	7
Salzburg, AT	6
Berlin, DE	6
Philadelphia, US	6
Bernard Price Institute for Palaeontological Researchlocation not on record	6
Tartu, EE	5
Göteborg, SE	5
Universidade de Lisboa, Museu Bocagelocation not on record	4
Kew, GB	4
WTUlocation not on record	4
Mexico City, MX	3
Helsinki, FI	3
Universidad Nacional Autonoma de Mexico, Instituto de Biologialocation not on record	3
Bardejov, SK	2
TUR-Alocation not on record	2
Catholic University of Pekinglocation not on record	2
Oulu, FI	1
Colorado State Universitylocation not on record	1
Bronx, US	1
Kuopio, FI	1
Görlitz, DE	1
Turku, FI	1
CA	1
Denver, US	1
National Biodiversity Institute, Costa Ricalocation not on record	1
Toronto, CA	1

32 institutions · 130 of 135 vouchered records shown · 5 without an institution code

09Environmental DNA3 detections

Where the DNA of Helvella albella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.2 °C 12.2–12.2

Seasonal swing summer↔winter5.90 °C

Max temp (day)16.2 °C

Min temp (night)6.90 °C

Precipitation224 mm/mo

Air humidity67.5 %

Moisture balance124 mm/mo

Vapour deficit464 Pa

Wind speed2.10 m/s

Cloud cover30.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.