Helophilus obscurus

Loew, 1863 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Helophilus

At a glance

Occurrence records588

Data sources7

Biological traits0

DNA specimens120

eDNA detections120

Sources7 archives

Databases and archives Helophilus obscurus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility588 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI120 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics120 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF588 records

Environmental DNA1 datasets · 1 countries120 detections

DNA & barcodingBOLD120 specimens

01Narrative

Helophilus obscurus (Loew, 1863), the Obscure Marsh Fly , is a common species of syrphid fly observed throughout Canada and the northern United States and Rocky Mountains. Hoverflies can remain nearly motionless in flight. The adults are also known as flower flies for they are commonly found on flowers, from which they get both enegy-giving nectar and protein rich pollen. The larvae of this genus are associated with wet decaying organic material, particularly accumulations of decaying vegetation in ponds and mud and farmyard manure or silage the larvae of this species are not known. .

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding120 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Helophilus obscurus has left across the world's sequence archives.

At a glance

DNA specimens120

BINs1

Marker genes1

eDNA detections120

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus118 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

343Tmostly conserved

TACATTATATTTTGTATTTGGAACATGAGCTGGAATAGTAGGAACTTCATTAAGTATATTAATTCGAGCAGAATTAGGACACCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.10%

Haplotypes10

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Helophilus lapponicussame genus3.8%Helophilus affinissame genus3.8%Helophilus groenlandicussame genus4.3%Helophilus pendulussame genus4.4%Helophilus virgatussame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type588 records

Wild obs. + sensor137

Museum / vouchered451

Range

Area of Occupancy AOO804 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 64≤1 km 15≤10 km 6>10 km 3

88 georeferenced · 49 without coordinates

Open the mapobservation + sensor137

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy90% within 1 km

≤100 m 63≤1 km 109≤10 km 17>10 km 2

191 georeferenced · 260 without coordinates

Open the institutions mapphysical evidence451

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Toronto, CA	145
Edmonton, CA	89
WIlocation not on record	81
University of Alberta Museums (UAM)location not on record	22
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
Chicago, US	2
University of Guelphlocation not on record	1
Saint John, CA	1

8 institutions · 351 of 451 vouchered records shown · 100 without an institution code

09Environmental DNA120 detections

Where the DNA of Helophilus obscurus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found120

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 120 detections have coordinates

Open the map1 country0

Wetland1. Forest & Woodland | 5. Wetlands (inland)4. Native Grassland|4.2 Subarctic GrasslandAgricultural field1. Forest & Woodland | 1.1 Boreal Forest1. Forest & Woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.2 °C 10.9–14.8

Seasonal swing summer↔winter37.0 °C

Max temp (day)15.1 °C 14.8–19.2

Min temp (night)8.70 °C 7.00–9.20

Precipitation96.1 mm/mo 56.4–101

Air humidity61.6 % 56.1–62.6

Moisture balance18.8 mm/mo -47.6–20.7

Vapour deficit510 Pa 489–659

Wind speed2.60 m/s 2.40–3.90

Cloud cover51.0 % 44.0–51.2

CHELSA 1981–2010, ~9 km grid, at location & month of 120 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)