Helopeltis antonii

V.Signoret, 1858 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Helopeltis

At a glance

Occurrence records25

Data sources6

Biological traits0

DNA specimens20

eDNA detections27

Sources6 archives

Databases and archives Helopeltis antonii's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility25 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF25 records

Environmental DNA1 datasets · 1 countries27 detections

DNA & barcodingBOLD20 specimens

01Narrative

Helopeltis antonii, also known as the tea mosquito bug, are heteropterans found within the Miridae family. They have a relatively large geographical distribution and are a known pest of many agricultural “cash” crops such as cocoa, cashew, and tea. Subsequently, their impact negatively influences economic growth within the regions in which they inhabit. Thus, their impact on humans has caused them to be of great interest biologically, resulting in significant environmental implications.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Helopeltis antonii has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes2

eDNA detections27

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus18 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

4Tmostly conserved

5Cmostly conserved

58Amostly conserved

88Amostly conserved

108Amostly conserved

135Amostly conserved

181Tvariable

223Tmostly conserved

226Cmostly conserved

457Tvariable

478Gvariable

532Tmostly conserved

544Avariable

623Gvariable

628Amostly conserved

634Cvariable

653Cmostly conserved

AATTCTATACTTCTTAATAGGTATCTGAGCAGGTATTTTAGGTATATCATTAAGATGAATTATCCGACTAGAACTTGGAACTACAGGACC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.66%

Haplotypes7

BIN1

Most divergent pair1.2%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Helopeltis bradyisame genus6.5%Helopeltis theivorasame genus11.6%Helopeltis sulawesisame genus14.1%Helopeltis cinchonaesame genus14.7%Monalonion bondarisame family15.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type25 records

Wild obs. + sensor21

Museum / vouchered4

Range

Area of Occupancy AOO76 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 5≤1 km 8≤10 km 1>10 km 1

15 georeferenced · 6 without coordinates

Open the mapobservation + sensor21

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA27 detections

Where the DNA of Helopeltis antonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found27

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 27 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.1 °C 17.6–28.5

Seasonal swing summer↔winter16.5 °C

Max temp (day)30.5 °C 24.0–34.2

Min temp (night)19.3 °C 11.2–23.0

Precipitation51.6 mm/mo 11.7–109

Air humidity52.0 % 51.3–56.4

Moisture balance-62.3 mm/mo -131–-17.8

Vapour deficit1,616 Pa 974–1,688

Wind speed1.80 m/s 1.30–2.60

Cloud cover14.1 % 13.5–25.2

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)