Helianthus tuberosus
speciesAt a glance
Occurrence records45 772
Data sources17
Biological traits136
DNA specimens28
eDNA detections19
Sources17 archives
Databases and archives Helianthus tuberosus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility45 772 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics28 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources136 traits
Chemical compositionFooDB · FoodAtlas · LOTUS · NPASS5 734 compounds
Occurrence & distributionGBIF45 772 records
Environmental DNA1 datasets · 5 countries19 detections
DNA & barcodingBOLD · NCBI28 specimens
Genome at a glanceCCDB · GoaT · NCBI10.6 Gbp
01Narrative
Le topinambour, aussi appelé artichaut de Jérusalem, truffe du Canada ou soleil vivace, est une espèce de plantes à fleurs de la famille des astéracées, qui appartient au même genre que le tournesol (Helianthus annuus). Elle est cultivée pour ses grandes fleurs jaunes comme plante décorative, et pour ses tubercules comestibles.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology18
Fruit length5 mm
Leaf length100 mm
Leaf length max225 mm
Leaf length min30 mm
Leaf mass628 mg
Leaf size19 578 mm²
Leaf width65 mm
Leaf width max80 mm
Leaf width min50 mm
Petiole length4.5 cm
Plant height2.25 m
⚠ sources differ — GIFT: 2.25 m · AusTraits: 3 m · LEDA: 1.75 m · USDA: 2.99 m · TRY: 1.83 m
Plant height generative1.65 m
Plant height max5 m
Plant height min1 m
Seed length7 mm
Seed mass3.84 mg
⚠ sources differ — TRY: 3.84 mg · GIFT: 4.53 mg
Seed mass max5.58 mg
Seed mass min2 mg
Life cycle & reproduction37
After harvest regrowth rateSlow
Bloom periodLate Summer
Coppice potentialNo
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeself
⚠ sources differ — LEDA: autochor · GIFT: unspecialized
Flower colouryellow
Flower conspicuousYes
Flowering endNov
Flowering startAug
Flowering timeyynnnnnnnnny
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formtuberous geophyte
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: perennial · LEDA: poly-annuals 5-50 years (medium-lived perennials) · GIFT: perennial
Lifespan categoryModerate
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersYes
Raunkiær life formcryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number100
Seed spread rateModerate
Seedling vigorMedium
Self fertilizationpresent
Sex typehermaphrodite
Vegetative spread rateRapid
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment31
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorYellow-Green
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Fruit typeachene
Growth formherb
Growth form USDARhizomatous
Habitat GIFTcultivated for the tubers as a valuable food plant
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Leaf shapelanceolate ovate
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min6 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry25
Anaerobic toleranceNone
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceHigh
Fertility requirementMedium
Fire resistantNo
Fire toleranceMedium
Frost free days min100 days
Leaf c404 mg/g
Leaf dry-matter content (LDMC)371 mg/g
⚠ sources differ — TRY: 371 mg/g · LEDA: 126 mg/g
Leaf n33.87 mg/g
Leaf p3.26 mg/g
Moisture useLow
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max55 in
Precipitation min15 in
Salinity toleranceLow
Shade toleranceMedium
Soil pH max7 pH
Soil pH min4 pH
Specific leaf area (SLA)20.29 mm²/mg
⚠ sources differ — TRY: 20.29 mm²/mg · LEDA: 31.05 mm²/mg · GIFT: 31.05 mm²/mg
Temperature min-43 °F
Wood density131 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalHigh
Palatable graze animalHigh
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound75 666 per lb
ToxicityNone
Veneer productNo
Other traits8
Diaspore typevegetative
Fall conspicuousYes
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max10 912 per acre
Planting density min4 800 per acre
Seeds per fruit101-1000
03Chemical composition5 734 compounds
Compounds documented for Helianthus tuberosus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingVegetables
Compound class profile5 classes
Aminoacids89
Glycerophospholipids57
Purine nucleos(t)ides36
Cinnamic acids and derivatives31
Unsaturated fatty acids29
Documented compounds5 734 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Sucrose | 51,650 mg/100g | FooDB | |
| α-D-galactose | 26,260 mg/100g | FooDB | |
| Sugars | 15,900 mg/100g | FooDB | |
| L-Glutamic acid | 2,649.3 mg/100g | FooDB | |
| Potassium | 2,176 mg/100g | FooDB | |
| L-Aspartic acid | 1,685.2 mg/100g | FooDB | |
| Arginine | 1,162.7 mg/100g | FooDB |
05DNA & barcoding28 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Helianthus tuberosus has left across the world's sequence archives.
At a glance
DNA specimens28
Marker genes6
GenBank sequences10
eDNA detections19
Countries5
The DNA barcodea real sequence read deposited for this species
TCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCA …
Helianthus tuberosus FP178 genes for 5.8S rRNA, ITS2, 28S rRNA, partial and complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK2★rbcL6★rbcLa★ITS2★ITS2
animal barcodeplant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Helianthus tuberosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size10 608 855 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Helianthus tuberosus10.61 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 102 n = 51
Ploidy6× hexaploid · measured
Chromosome records102–1022n range102median102mode21records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 10221×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · nw-europe-fl +7
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Murín A. & Feráková V., 1981: Karyological study of Slovakian flora III. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 28: 59-62.
CCDB · slov-fl — Feráková V., 2007: [New records in Artemisia, Chorispora, Crepis, Erucastrum, Fallopia, Helianthus, Lactuca, and Persicaria], pp. 111, 193, 214, 243, 258, 302, 354, 430. - In: Marhold K., Mártonfi P., Mereďa P. jun., Mráz P. (eds), Chromosome number survey of the ferns and flowering plants of Slovakia. Veda, Bratislava.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4134
CCDB · poland — Pogan E., Jankun A., Wcis?o H. et al. 1990. Further studies in chromosome numbers of Polish Angiosperms. Part XXIII. Acta Biol. Cracov. Ser. Bot. 32, 171-188.
CCDB · ipcn-api-dl — Wcis|1lo, H. 1990. In Further studies in chromosome numbers of Polish angiosperms, part 23. Acta Biol. Cracov., Ser. Bot. 32: 175–177, 181.
CCDB · ipcn-api-dl — Murin, A. 1976. In: Index of chromosome numbers of Slovian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · ipcn-api-dl — Murin, A. & V. Ferakova. 1981. Caryological study of Slovakian flora III. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 28: 59–62.
CCDB · ipcn-api-dl — Kulshreshtha, V. B. & P. K. GUPTA. 1981. Cytogenetic studies in the genus Helianthus L. II. Karyological studies in twelve species. Cytologia 46: 279–289.
CCDB · ipcn-api-dl — Murin, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
CCDB · ipcn-api-dl — Mohan, G. S. R. & A. Seetharam. 2005. Studies on genetic relationships among cultivated and wild sunflowers through RAPD markers. Cytologia 70: 267–273.
CCDB · ipcn-api-dl — Love, A. & H. E. Connor. 1982. Relationships and taxonomy of New Zealand wheat grasses. New Zealand J. Bot. 20: 169–186.
CCDB · book-indian_vol1 — Makoveltski, M. (Fedorov) ; Yamo- moto, Y. (Kihara, H. et al. 1931); Wagner, S. 1932 ; Kostoff, D. (Fedo- rov) ; Schewtschenko (Fedorov) ; Cle- venger, S. & Heiser, C.B. 1963; Georgieva-Todorova, I. 1973 ; Anas- hchenko, A.V. 1974; Ki.dshreshtha, V.B. & Gupta, P. K. 1979
CCDB · eflora
CCDB · book-atlas-flowering-plants
CCDB · kew — Ingle J, Sinclair J. 1972. Ribosomal RNA genes and plant development. Nature 235: 30-32.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXV]. Taxon 31(2): 344-360.
n 515×CCDB · ipcn-api-dl · CCDB · Cave1956 · CCDB · Cave1956supp +1
CCDB · ipcn-api-dl — Kulshreshtha, V. B. & P. K. GUPTA. 1979. Cytogenetic studies in the genus Helianthus L. Cytologia 44: 325–334.
CCDB · Cave1956 — Jackson
CCDB · Cave1956supp — Heiser & Smith 1955
CCDB · Cave1963 — Clev. & Heiser 1963
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
hexaploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type45 772 records
Wild obs. + sensor39 748
Museum / vouchered5 067
Cultivated / captive165
Other792
Origin
Introduced636
Range
Area of Occupancy AOO104 640 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy61% within 1 km
≤100 m 12 113≤1 km 3 238≤10 km 9 349>10 km 357
25 057 georeferenced · 14 691 without coordinates
Open the mapobservation + sensor39 748
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy48% within 1 km
≤100 m 362≤1 km 851≤10 km 1 218>10 km 74
2 505 georeferenced · 2 562 without coordinates
Open the institutions mapphysical evidence5 067
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 81>10 km 7
88 georeferenced · 77 without coordinates
Open the mapnot free-living165
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions196 of 323 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Bloomington, US | 354 |
| Uniwersytet Wrocławskilocation not on record | 284 |
| BIO-UNIPIlocation not on record | 269 |
| Wuzhou, CN | 198 |
| Chongqing Museumlocation not on record | 164 |
| Madison, US | 158 |
| Uniwersytet Warszawskilocation not on record | 140 |
| Philadelphia, US | 125 |
| Odawara, JP | 122 |
| St. Paul, US | 118 |
| Beijing, CN | 97 |
| Bronx, US | 77 |
| DBF-NHMDlocation not on record | 72 |
| BFLlocation not on record | 66 |
| Williamsburg, US | 61 |
| Nagano City, JP | 60 |
| Moscow State Universitylocation not on record | 58 |
| Chengdu, CN | 53 |
| Shinshu Universitylocation not on record | 52 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 50 |
| SLU Artdatabankenlocation not on record | 49 |
| Saint Louis, US | 49 |
| Chiba, JP | 46 |
| Guangzhou, CN | 43 |
| Central China Normal Universitylocation not on record | 42 |
| Olocation not on record | 42 |
| Görlitz, DE | 42 |
| Wuhan, CN | 41 |
| University of Stellenboschlocation not on record | 39 |
| Nanjing, CN | 36 |
| Fort Worth, US | 36 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 36 |
| Jena Microbial Resource Collectionlocation not on record | 35 |
| Tartu, EE | 32 |
| BDBClocation not on record | 31 |
| MeiseBGlocation not on record | 29 |
| Bando, JP | 29 |
| Adam Mickiewicz University in Poznańlocation not on record | 29 |
| Kunming, CN | 29 |
| Ann Arbor, US | 28 |
| Chadron, US | 27 |
| Sichuan Agricultural Universitylocation not on record | 26 |
| Davenport, US | 25 |
| Provincia di Livornolocation not on record | 25 |
| Montréal, CA | 24 |
| New Haven, US | 24 |
| Barcelona, ES | 23 |
| LDlocation not on record | 22 |
| Burlington, US | 22 |
| Lincoln, US | 22 |
| Allentown, US | 21 |
| Salzburg, AT | 20 |
| Kochi, JP | 19 |
| Spearfish, US | 18 |
| Tsukuba, JP | 18 |
| València, ES | 17 |
| Guilin, CN | 17 |
| College Park, US | 17 |
| MAlocation not on record | 17 |
| Québec, CA | 17 |
| National Institute of Biological Resourceslocation not on record | 17 |
| Sanda, JP | 16 |
| Chapel Hill, US | 16 |
| KIRMlocation not on record | 16 |
| Hiratsuka City Museumlocation not on record | 15 |
| Fayetteville, US | 14 |
| Toyama, JP | 14 |
| Tomioka, JP | 13 |
| University of New Hampshirelocation not on record | 13 |
| KMNlocation not on record | 12 |
| Saint John, CA | 12 |
| Canadian Department of Agriculturelocation not on record | 12 |
| Hangzhou, CN | 12 |
| Dekalb, US | 12 |
| Mlocation not on record | 12 |
| Jackson, US | 11 |
| Staten Island, US | 11 |
| Christchurch, NZ | 11 |
| Auckland, NZ | 11 |
| BRNUlocation not on record | 11 |
| Uniwersytet Śląski w Katowicachlocation not on record | 11 |
| Vancouver, CA | 11 |
| Bangkok, TH | 10 |
| NSMKlocation not on record | 10 |
| WNNUlocation not on record | 10 |
| Nagatoro-machi, Chichibu-gun, JP | 10 |
| Mount Annan, AU | 10 |
| Acadia Universitylocation not on record | 10 |
| Emporia, US | 10 |
| Berlin, DE | 10 |
| Claremont, US | 10 |
| Wuhan, CN | 9 |
| Green Bay, US | 9 |
| GB | 9 |
| Toronto, CA | 9 |
| Fukushima Universitylocation not on record | 9 |
| Knoxville, US | 9 |
| US | 9 |
| Oskarshamn, SE | 9 |
| Pullman, US | 8 |
| Changsha, CN | 8 |
| GJOlocation not on record | 8 |
| Otaru, JP | 8 |
| Oulu, FI | 8 |
| BClocation not on record | 7 |
| Pittsburg, US | 7 |
| Rotorua, NZ | 7 |
| Hunan Hupingshan National Nature Reservelocation not on record | 7 |
| Bern, CH | 7 |
| Morgantown, US | 7 |
| Entomological Society of Latvialocation not on record | 7 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 7 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 7 |
| Norfolk, US | 7 |
| Nijmegen, NL | 7 |
| Chengdu, CN | 7 |
| Sagamihara, JP | 7 |
| South Kensington, GB | 6 |
| Zhengzhou, CN | 6 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 6 |
| Karlsruhe, DE | 6 |
| Philadelphia, US | 6 |
| Philadelphia, US | 6 |
| KURAlocation not on record | 6 |
| Denver, US | 6 |
| Kirksville, US | 6 |
| Millersville, US | 6 |
| Osaka, JP | 6 |
| Richmond, US | 5 |
| Strecker Museum, Baylor Universitylocation not on record | 5 |
| Akita Prefectural Museumlocation not on record | 5 |
| Xishuangbanna Tropical Botanical Garden, Academia Sinicalocation not on record | 5 |
| Springfield, US | 5 |
| New Brunswick, US | 5 |
| Harrisonburg, US | 5 |
| Museo Entomologico de Leonlocation not on record | 5 |
| Columbia, US | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| University of Alberta Museumslocation not on record | 4 |
| Minia, EG | 4 |
| CICYTEXlocation not on record | 4 |
| Seoul, KR | 4 |
| Granada, ES | 4 |
| Austin, US | 4 |
| Miami, US | 4 |
| Guiyang, CN | 4 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 4 |
| Trondheim, NO | 4 |
| Corvallis, US | 4 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 4 |
| Zhejiang Universitylocation not on record | 4 |
| Salamanca, ES | 4 |
| John May Museum of Natural Historylocation not on record | 4 |
| KOMlocation not on record | 4 |
| Turku, FI | 4 |
| Nishihara, JP | 4 |
| Riverside, US | 4 |
| Jefferson City, US | 4 |
| 盐城国家级珍禽自然保护区location not on record | 4 |
| GAlocation not on record | 4 |
| CJBGlocation not on record | 4 |
| Hudson, US | 4 |
| Toyota city nature sanctuarylocation not on record | 3 |
| Tokushima, JP | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Fulda, DE | 3 |
| Adelaide, AU | 3 |
| IWEP FEB RASlocation not on record | 3 |
| Macomb, US | 3 |
| Santa Barbara, US | 3 |
| Université Lavallocation not on record | 3 |
| McWane Science Centerlocation not on record | 3 |
| Museum of the Rockieslocation not on record | 3 |
| WINlocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| KIWElocation not on record | 3 |
| KR | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| Victoria, CA | 3 |
| SXTCMlocation not on record | 3 |
| Chicago, US | 3 |
| Madrid, ES | 3 |
| JP | 3 |
| Awka, NG | 3 |
| Urumqi, CN | 3 |
| KNAMlocation not on record | 3 |
| ENTClocation not on record | 3 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 2 |
| Canberra, AU | 2 |
| Yunnan Universitylocation not on record | 2 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| nlocation not on record | 2 |
| Shenzhen, CN | 2 |
| Armidale, AU | 2 |
| San Isidro, AR | 2 |
| Lord Fairfax Community Collegelocation not on record | 2 |
| Missoula, US | 2 |
| SZUlocation not on record | 2 |
| Little Rock, US | 2 |
| Bourges, FR | 2 |
| Bozeman, US | 2 |
| Blacksburg, US | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Jaén, ES | 2 |
| Uppsala, SE | 2 |
| Pamplona, ES | 2 |
| Shanghai, CN | 2 |
| Pamplona, ES | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Vitoria, ES | 2 |
| Kawasaki Shi Tama Ku, JP | 2 |
| ROM023location not on record | 2 |
| AUAlocation not on record | 2 |
| IDElocation not on record | 2 |
| Fujian Institute of Subtropical Botanylocation not on record | 2 |
| US | 2 |
| Fairfax, US | 2 |
| JBRJlocation not on record | 2 |
| Brussel, BE | 2 |
| Denton, US | 2 |
| Phoenix, US | 2 |
| Fredericksburg, US | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Ishikawa Museum of Natural Historylocation not on record | 2 |
| Shanghai, CN | 2 |
| Hobart, AU | 2 |
| USP-IBlocation not on record | 2 |
| Ivano-Frankove, UA | 2 |
| Stockholm, SE | 2 |
| Maryland Department of Natural Resourceslocation not on record | 2 |
| Xian, CN | 2 |
| Chengdu, CN | 2 |
| Guangzhou, CN | 2 |
| Kensington, AU | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Provo, US | 2 |
| Lanzhou, CN | 2 |
| Jinghong, CN | 2 |
| Taipei, TW | 2 |
| Davis, US | 2 |
| State University of New York, College at Oneontalocation not on record | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 2 |
| Elikins, US | 1 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 1 |
| Brookings, US | 1 |
| Moscow, US | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| QVMAGlocation not on record | 1 |
| Jyväskylä, FI | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Cambridge, US | 1 |
| PRClocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| Valparaiso, CL | 1 |
| Dover, US | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Durham, US | 1 |
| Badajoz, ES | 1 |
| GZUlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| UIBlocation not on record | 1 |
| Xian, CN | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Johnson City, US | 1 |
| Frankfurt am Main | 1 |
| Porto Alegre, BR | 1 |
| PrivatHerblocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Portland, US | 1 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| Córdoba, AR | 1 |
| Nanjing, CN | 1 |
| Santa Cruz, US | 1 |
| UMKClocation not on record | 1 |
| Namur, BE | 1 |
| Córdoba, ES | 1 |
| ASUlocation not on record | 1 |
| H-Hohlalocation not on record | 1 |
| Oiso Municipal Museumlocation not on record | 1 |
| Zhejiang Museum of Natural Historylocation not on record | 1 |
| Wlocation not on record | 1 |
| Long Beach, US | 1 |
| Kagoshima, JP | 1 |
| Dresden, DE | 1 |
| Trois-Rivières, CA | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Taipei, TW | 1 |
| Kingston, US | 1 |
| Hamilton, US | 1 |
| Decorah, US | 1 |
| Mount Pleasant, US | 1 |
| Mississippi State, US | 1 |
| Bergen, NO | 1 |
| Obihiro Centennial City Museumlocation not on record | 1 |
| Alicante, ES | 1 |
| Tacoma, US | 1 |
| San Angelo, US | 1 |
| Logan, US | 1 |
| AZE014location not on record | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| Kew, GB | 1 |
| TUR-Alocation not on record | 1 |
| Lubbock, US | 1 |
| Cincinnati, US | 1 |
| USFS/BHSClocation not on record | 1 |
| Cape Town, ZA | 1 |
| Tampa, US | 1 |
| FJIDClocation not on record | 1 |
| EL PASO, US | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| CASlocation not on record | 1 |
| Bend, US | 1 |
| Wellington, NZ | 1 |
| NMBU:MINAlocation not on record | 1 |
| Brisbane, AU | 1 |
| Cambridge, US | 1 |
| Zürich, CH | 1 |
| WTUlocation not on record | 1 |
323 institutions · 4 798 of 5 067 vouchered records shown · 194 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA19 detections
Where the DNA of Helianthus tuberosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found19
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 19 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.5 °C 5.00–15.4
Seasonal swing summer↔winter23.3 °C
Max temp (day)17.9 °C 7.00–20.4
Min temp (night)9.10 °C 3.20–11.4
Precipitation85.7 mm/mo 68.9–98.3
Air humidity62.0 % 57.3–65.5
Moisture balance-5.70 mm/mo -38.4–53.6
Vapour deficit632 Pa 279–797
Wind speed3.90 m/s 2.90–5.80
Cloud cover45.4 % 37.1–59.6
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.