Helianthus annuus
speciesAt a glance
Occurrence records72 499
Data sources17
Biological traits146
DNA specimens63
eDNA detections472
Sources17 archives
Databases and archives Helianthus annuus's data was compiled from.
WikipediaWikimedia Foundation22 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility72 499 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI472 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics63 specimens↗
NCBIUS National Library of Medicinesequences↗
dukesphytochemcompounds
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources146 traits
Chemical compositionDukesPhytochem · FooDB · LOTUS · NPASS6 516 compounds
Occurrence & distributionGBIF72 499 records
Environmental DNA5 datasets · 9 countries472 detections
DNA & barcodingBOLD · NCBI63 specimens
Genome at a glanceCCDB · GoaT · NCBI3.6 Gbp
01Narrative
The common sunflower (Helianthus annuus) is a large annual forb of the genus Helianthus grown as a crop for its edible oil and seeds. This sunflower species is also used as wild bird food, as livestock forage (as a meal or a silage plant), in some industrial applications, and as an ornamental in domestic gardens. The plant was first domesticated in the Americas. Wild H. annuus is a widely branched annual plant with many flower heads. The domestic sunflower, however, often possesses only a single large inflorescence (flower head) atop an unbranched stem. The binomial name Helianthus annuus is derived from the Greek Helios 'sun' and anthos 'flower', while the epithet annuus means 'annual' in Latin. Sunflower seeds were brought to Europe from the Americas in the 16th century, where, along with sunflower oil, they became a widespread cooking ingredient.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology25
Fruit length5.5 mm
⚠ sources differ — AusTraits: 5.5 mm · GIFT: 12.75 mm
Fruit length max15 mm
Fruit length min5 mm
Leaf length115 mm
Leaf length max400 mm
Leaf length min30 mm
Leaf mass534 mg
Leaf size22 277 mm²
⚠ sources differ — TRY: 22 277 mm² · LEDA: 10 901 mm² · GIFT: 10 901 mm²
Leaf width60 mm
Leaf width max100 mm
Leaf width min10 mm
Petiole length5.5 cm
Plant height2.17 m
⚠ sources differ — GIFT: 2.17 m · AusTraits: 1.25 m · LEDA: 1.8 m · USDA: 2.74 m · TRY: 2.74 m
Plant height generative2 m
Plant height max4 m
Plant height min0.2 m
Seed length12 mm
Seed length max12 mm
Seed length min12 mm
Seed mass44.57 mg
⚠ sources differ — TRY: 44.57 mg · GIFT: 26.22 mg
Seed mass max120 mg
Seed mass min1.7 mg
Seed volume44 mm³
Seed volume max44 mm³
Seed volume min44 mm³
Life cycle & reproduction37
Bloom periodSummer
Coppice potentialNo
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourbrown
⚠ sources differ — GIFT: brown · USDA: Yellow
Flower conspicuousYes
Flower length max800 mm
Flower length min300 mm
Flowering endSep
Flowering startJul
Flowering timennnnnnnnnnnn
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDARapid
Life formannual
Life spanannual
⚠ sources differ — TRY: annual · AusTraits: annual biennial · LEDA: summer annuals · GIFT: annual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formtherophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number500
Seed spread rateModerate
Seedling vigorLow
Self fertilizationpresent
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment33
Active growth periodSummer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max1 000 m
Elevation mean2 630 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterModerate
Foliage textureCoarse
Fruit colourblue
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Growth form USDASingle Crown
Habitat GIFTLowland
Hedge toleranceNone
Known allelopathNo
Leaf compoundnesssimple
Leaf retentionNo
Leaf shapeovate triangular
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min8 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry25
Anaerobic toleranceLow
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementLow
Fire resistantNo
Fire toleranceNone
Frost free days min80 days
Leaf c400 mg/g
Leaf dry-matter content (LDMC)130 mg/g
Leaf n34.24 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min12 in
Protein potentialMedium
Salinity toleranceMedium
Seed longevity index0.5
Shade toleranceHigh
Soil pH max7.8 pH
Soil pH min5.5 pH
Specific leaf area (SLA)14.74 mm²/mg
⚠ sources differ — TRY: 14.74 mm²/mg · LEDA: 19.23 mm²/mg · GIFT: 19.23 mm²/mg
Temperature min52 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalMedium
Palatable humanYes
Post productNo
Pulpwood productNo
Seeds per pound46 919 per lb
ToxicityNone
Veneer productNo
Other traits9
Diaspore typefruit
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousYes
Fruit seed persistenceYes
Leaf arrangementalternate
Planting density max11 000 per acre
Planting density min4 800 per acre
Shoot orientationerect
03Chemical composition6 516 compounds
Compounds documented for Helianthus annuus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingHerbs and Spices
Compound class profile5 classes
Aminoacids209
Germacrane sesquiterpenoids62
Cinnamic acids and derivatives57
Glycerophospholipids57
Unsaturated fatty acids54
Documented compounds6 516 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| FAT | 523,800 ppm | DukesPhytochem | |
| LINOLEIC-ACID | 350,000 ppm | DukesPhytochem | |
| PUFA | 345,900 ppm | DukesPhytochem | |
| FIBER | 323,000 ppm | DukesPhytochem | |
| MENTHOL | 310,000 ppm | DukesPhytochem | |
| LIGNIN | 300,000 ppm | DukesPhytochem | |
| PENTOSANS | 290,000 ppm | DukesPhytochem | |
| PROTEIN | 248,615 ppm | DukesPhytochem | |
| CARBOHYDRATES | 213,000 ppm | DukesPhytochem | |
| OLEIC-ACID | 178,000 ppm | DukesPhytochem |
05DNA & barcoding63 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Helianthus annuus has left across the world's sequence archives.
At a glance
DNA specimens63
Marker genes7
GenBank sequences10
eDNA detections472
Countries9
The DNA barcodea real sequence read deposited for this species
GCATTTCGAGTAACTCCTCAACCTGGAGTTCCGCCTGAAGAAGCAGGGGCCGCAGTAGCTGCCGAATCTTCTACTGGTACATGGACAACT …
Helianthus annuus subsp. annuus cv. AlexBA-C14 chloroplast rbcL gene for ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial cds
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK1★rbcL9★rbcLa★trnL-F★ITS1★ITS2
animal barcodeplant barcodefungal barcode
Organelle genome
Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.
▸ Tap any coloured segment — or a gene chip — to see what it is
Mitochondrion
NC_023337 ↗ · 26 protein · 15 tRNA · 3 rRNA
ccmCatp4nad4Latp8coxIIIrpl5ccmBrpl10coxInad5atp9rps4rps13nad6cobccmFcorf873atp1ccmFnrpl16matRnad3rps12nad9atp6rrn26+2
Pick a coloured segment on the ring — or a gene chip — to read what that gene does.
protein-codingrRNAtRNA
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Helianthus annuus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 635 715 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Helianthus annuus3.64 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 34 n = 17
Ploidy2× diploid · measured
Chromosome records20–342n range34median34mode47records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3446×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · iapt +10
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Murín A., 1993: Karyologické štúdium okrasných rastlín flóry Slovenska. - Biológia (Bratislava) 48/4: 441-445.
CCDB · iapt — IAPT/IOPB Chromosome Data 13
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4130
CCDB · poland — Pogan E. and Wcis?o H. 1989. Cytological investigations on Hieracium pilosella L. from Poland. I. Karyological studies. Acta Biol. Cracov. Ser. Bot. 31, 19-28.
CCDB · ipcn-api-dl — Dutta, R. & G. N. Bhattacharya. 1982. Chromosomes in some varieties of Helianthus annuus L. Proc. Indian Sci. Congr. Assoc. 69(3–VI): 233.
CCDB · ipcn-api-dl — Liu, H., Z. S. Zeng & R. Q. Li. 1984. Analysis on karyotypes of three varieties of Helianthus annuus. Zhongguo Youliao (Chin. Edible Oil Crops). (3): 22–26. (In Chinese).
CCDB · ipcn-api-dl — Li, M. x. 1987. Karyotype analysis of some oil plants. Acta Bot. Boreal.-Occid. Sin. 7: 246–251.
CCDB · ipcn-api-dl — Bandyopadhyay, A. & R. Gupta. 1985. Initiation maintenance and cytological study of callus of Helianthus annuus L. var. EC68414. Proc. Indian Sci. Congr. Assoc. 72(3–VI): 193.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun & K. TurasLa-Szybowska. 1987. Further studies in chromosome numbers of Polish angiosperms. Part XX. Acta Biol. Cracov., Ser. Bot. 29: 1–17.
CCDB · ipcn-api-dl — Ferreira, V. 1985. Viabilidad y citogenetica de los hibridos entre tres especies de Helianthus. Mendeliana 7: 13–30.
CCDB · ipcn-api-dl — Cui, Q. h., R. h. Wei & L. j. Han. 1989. Study on the karyotype of sunflower (Helianthus annuus L.). Acta Agric. Univ. Jilin. 11: 23–25.
CCDB · ipcn-api-dl — Selvaraj, R. 1988. Cytomorphological studies in Helianthus annuus Linn. Proc. Indian Sci. Congr. Assoc. 75(3–VI): 189.
CCDB · ipcn-api-dl — Nirmala, A. & P. N. Rao. 1984. Karyotype studies in Asteraceae. Cell Chromosome Res. 7: 26–28.
CCDB · ipcn-api-dl — Murín, A. 1993. Karyologické atúdium okrasn@3ych rastlín flóry Slovenska. Biologia (Bratislava) 48: 441–445.
CCDB · ipcn-api-dl — Jose, J. C. & P. M. Mathew. 1995. Chromosome numbers in the south Indian Heliantheae (Compositae). Compositae Newslett. 27: 7–10.
CCDB · ipcn-api-dl — Fuchs, J., A. Brandes & I. Schubert. 1995. Telomere sequence localization and karyotype evolution in higher plants. Pl. Syst. Evol. 196: 227–241.
CCDB · ipcn-api-dl — Zhang, X. l., P. l. Zhang & J. Yin. 1995. Karyotype analyses of six sunflower varieties. J. August 1 Agric. Coll. 18(3): 100–103.
CCDB · ipcn-api-dl — Zhan, Y. x., X. c. Zhou, A. z. Wu & M. Cheng. 1990. Karyotype analysis of some cultivars with different uses of Helianthus annuus L. Acta Agric. Univ. Pekin. 16(3): 249–253.
CCDB · ipcn-api-dl — Zhang, C. s. 1998. A preliminary study on making plant chromosomal specimens using peppermint oil compound as pretreatment agent. J. Wuhan Bot. Res. 16(3): 280–282.
CCDB · ipcn-api-dl — Ramakanth, R. S. & A. SEETHARAM. 1977. Cytomorphological studies in the genus Helianthus. 1. Karyotype studies in the diploid species. Proc. Indian Acad. Sci., B 86: 155–158.
CCDB · ipcn-api-dl — Gupta, S. K. & S. K. Roy. 1980. Cochiploid sunflower. Sci. & Cult. 46: 294–295.
CCDB · ipcn-api-dl — Keil, D. J. 1981. In Chromosome number reports LXXII. Taxon 30: 705–706.
CCDB · ipcn-api-dl — Kovanda, M. 1978. Chromosome numbers of miscellaneous United States dicotyledons. Rhodora 80: 431–440.
CCDB · ipcn-api-dl — Kulshreshtha, V. B. & P. K. GUPTA. 1979. Cytogenetic studies in the genus Helianthus L. Cytologia 44: 325–334.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · ipcn-api-dl — Dasgupta, A. 1975. Chromosome studies on certain ornamental varieties of Helianthus annuus L. Bull. Bot. Soc. Bengal 29: 13–19.
CCDB · ipcn-api-dl — GUPTA, A. D. 1976a. Chromosome studies in Helianthus annuus. Sci. & Cult. 42: 111–112.
CCDB · ipcn-api-dl — Mohan, G. S. R. & A. Seetharam. 2005. Studies on genetic relationships among cultivated and wild sunflowers through RAPD markers. Cytologia 70: 267–273.
CCDB · ipcn-api-dl — De Paula Wilson. 2005. Functionality of major and minor 45S rDNA sites in different diploid wild species and varieties of sunflowers. Caryologia 58(4): 374–379.
CCDB · ipcn-api-dl — Love, A. & H. E. Connor. 1982. Relationships and taxonomy of New Zealand wheat grasses. New Zealand J. Bot. 20: 169–186.
CCDB · ipcn-api-dl — Probatova, N. S., A. P. Sokolovskaja & E. G. Rudyka. 1991. Chromosome numbers in some species of vascular plants from the Soviet Far East and other regions of the USSR. Bot. Žhurn. (Moscow & Leningrad) 76: 1174–1178.
CCDB · ipcn-api-dl — Kulshreshtha, V. B. & P. K. GUPTA. 1981. Cytogenetic studies in the genus Helianthus L. II. Karyological studies in twelve species. Cytologia 46: 279–289.
CCDB · book-ipcn67-71 — KODAMA, A. 1970. Cytological and morphological studies on the plant tumors III. Crown galls in three host species, Haplopappus gracilis, Helianihus annuus and Lathyrus odoratus. J. Sci. Hiroshima Univ. Ser. B. Div. 2, 13: 265-284.
CCDB · book-ipcn73-74 — KODAMA, A. 1974. Karyotype analyses of crown gall cells of the sunflower. Bull. Hiroshima Agr. Cell. 5: 15-21.
CCDB · book-indian_vol1 — Tahara, M. 1915g ; Prosina, M.N. (Fedorov) ; Makoveltski, M. (Fedo- rov); Geisler, F. 1931 ; Yamamoto, Y. (Kihara, H. et at. 1931) ; Wagner, S. 1932 ; Tischler, G. 1937; Aleskovsky, M.K. (Fedorov) ; Klimochkina, L.V. (Fedorov) ; Ioffe, E.U. (Fedorov) ; Kostoff, D. (Fedorov) ; Delay, C. 1947 ; Heiser, C.B. & Whitaker, T.W. 1948; Heiser, C.B. 1958 ; Heiser, C.B. & Smith, D.M. 1959 ; Kodama, A. 1970a; Solbrig, O.T. et al. 1972; Georgieva- Todorova, I. 1973; Anashchenko, A.V. 1974; Mehra, P.N. & Remanandan, P. 1974; Dasgupta, A. 1975; Raicu, P. et al. 1976; Whelan, E.D.P. 1978 ; Al- Allaf, S. & Godward, M.B.E. 1979a, b ; Kulshreshtha, V.B. & Gupta, P.K. 1979
CCDB · eflora
CCDB · book-atlas-flowering-plants — Geisler 1931
CCDB · book-atlas-flowering-plants — California
+3 more references
2n 201×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Murin, A. 1978. In Index of chromosome numbers of Slovakian flora. Part 6. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1–42.
n 1724×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn73-74
CCDB · ipcn-api-dl — Powell, A. M. & S. A. Powell. 1978. Chromosome Numbers in Asteraceae. Madroño 25(3): 160–169.
CCDB · ipcn-api-dl — Pandey, R. M. 1982. Male meiosis in a naturally occurring hybrid between Helianthus debilis Nutt. and H. annuus L. New Bot. 9: 61–67.
CCDB · ipcn-api-dl — Cavallini, A. & R. Cremonini. 1985. Aneusomity in sunflower (Helianthus annuus L.). Z. Pflanzenz;auucht. 95: 118–124.
CCDB · ipcn-api-dl — Keil, D. J., M. A. Luckow & D. J. Pinkava. 1988. Chromosome studies in Asteraceae from the United States, Mexico, the West Indies, and South America. Amer. J. Bot. 75: 652–668.
CCDB · ipcn-api-dl — Jackson, R. C. 1988. A quantitative cytogenetic analysis of an intersectional hybrid in Helianthus (Compositae). Amer. J. Bot. 75: 609–614.
CCDB · ipcn-api-dl — Gill, L. S. & I. D. Omoigui. 1987. The incidence of polyploidy in family Asteraceae in southern Nigeria. Rev. Cytol. Biol. Vég., Bot. 10: 177–184.
CCDB · ipcn-api-dl — Mathew, A. & P. M. Mathew. 1988. Cytological studies on the south Indian Compositae. Glimpses Pl. Res. 8: 1–177.
CCDB · ipcn-api-dl — Gupta, R. C. & B. S. Gill. 1989. Cytopalynology of north and central Indian Compositae. J. Cytol. Genet. 24: 96–105.
CCDB · ipcn-api-dl — Chand, H., R. K. Grover & P. K. Sareen. 1991. Carbendazim induced chromosomal aberrations in somatic and reproductive cells of pearl-millet and sunflower. Cytologia 56: 559–566.
CCDB · ipcn-api-dl — Razaq, Z. A., A. A. Vahidy & S. I. Ali. 1994. Chromosome numbers in Compositae from Pakistan. Ann. Missouri Bot. Gard. 81: 800–808.
CCDB · ipcn-api-dl — Jose, J. C. & P. M. Mathew. 1995. Chromosome numbers in the south Indian Heliantheae (Compositae). Compositae Newslett. 27: 7–10.
CCDB · ipcn-api-dl — Ramakanth, R. S. & A. SEETHARAM. 1977. Cytomorphological studies in the genus Helianthus. 1. Karyotype studies in the diploid species. Proc. Indian Acad. Sci., B 86: 155–158.
CCDB · ipcn-api-dl — Al-allaf, S. & M. B. E. Godward. 1979. Karyotype analysis of four varieties of Helianthus annuus L. Cytologia 44: 319–323.
CCDB · ipcn-api-dl — Keil, D. J. 1981. In Chromosome number reports LXXII. Taxon 30: 705–706.
CCDB · ipcn-api-dl — Kulshreshtha, V. B. & P. K. GUPTA. 1979. Cytogenetic studies in the genus Helianthus L. Cytologia 44: 325–334.
CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.
CCDB · ipcn-api-dl — Dasgupta, A. 1975. Chromosome studies on certain ornamental varieties of Helianthus annuus L. Bull. Bot. Soc. Bengal 29: 13–19.
CCDB · ipcn-api-dl — GUPTA, A. D. 1976a. Chromosome studies in Helianthus annuus. Sci. & Cult. 42: 111–112.
CCDB · ipcn-api-dl — Ferreira, V. 1985. Viabilidad y citogenetica de los hibridos entre tres especies de Helianthus. Mendeliana 7: 13–30.
CCDB · ipcn-api-dl — Kulshreshtha, V. B. & P. K. GUPTA. 1981. Cytogenetic studies in the genus Helianthus L. II. Karyological studies in twelve species. Cytologia 46: 279–289.
CCDB · book-ipcn72 — SOLBRIG, O.T., D.W. KYHOS, M. POWELL, & P.H. RAVEN. 1972. Chromosome numbers in Compositae VIII: Heliantheae. Amer. J. Bot. 59: 869-878.
CCDB · book-ipcn73-74 — MEHRA, P.N., & R. REMANANDAN. 1974. Cytolog>cal >nvestigat>ons on th[ Indian Compositae. II. Astereae, Hel~antheae, Helenleae, and Anthemideae. Caryologia 27: 255-289.
n 181×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Kovanda, M. 1978. Chromosome numbers of miscellaneous United States dicotyledons. Rhodora 80: 431–440.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
07Deep time~0.34 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin0.34 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type72 499 records
Wild obs. + sensor60 050
Museum / vouchered8 003
Cultivated / captive592
Other3 854
Origin
Native1 706
Introduced2 099
Range
Area of Occupancy AOO167 048 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy75% within 1 km
≤100 m 29 952≤1 km 7 085≤10 km 11 319>10 km 1 355
49 711 georeferenced · 10 339 without coordinates
Open the mapobservation + sensor60 050
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy55% within 1 km
≤100 m 1 057≤1 km 1 217≤10 km 1 547>10 km 304
4 125 georeferenced · 3 878 without coordinates
Open the institutions mapphysical evidence8 003
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 39>10 km 3
42 georeferenced · 550 without coordinates
Open the mapnot free-living592
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions227 of 393 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Wuzhou, CN | 442 |
| Bloomington, US | 339 |
| Chapingo, MX | 313 |
| ROM026location not on record | 299 |
| HUN003location not on record | 291 |
| Bronx, US | 199 |
| Austin, US | 162 |
| Fort Worth, US | 149 |
| ASUlocation not on record | 146 |
| Riverside, US | 119 |
| San Diego, US | 117 |
| Albuquerque, US | 113 |
| Olocation not on record | 111 |
| Paris, FR | 90 |
| Denver, US | 90 |
| Claremont, US | 89 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 87 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 83 |
| US | 81 |
| Flagstaff, US | 80 |
| Chongqing Museumlocation not on record | 79 |
| Philadelphia, US | 70 |
| Spearfish, US | 69 |
| Allentown, US | 67 |
| DOI/NPS, Greenbelt Parklocation not on record | 65 |
| Mexico City, MX | 65 |
| LDlocation not on record | 64 |
| Adelaide, AU | 63 |
| Chadron, US | 62 |
| TROMlocation not on record | 61 |
| Pullman, US | 60 |
| University of Stellenboschlocation not on record | 59 |
| Uniwersytet Warszawskilocation not on record | 58 |
| SLU Artdatabankenlocation not on record | 56 |
| Santa Barbara, US | 53 |
| WTUlocation not on record | 53 |
| Provo, US | 52 |
| Corvallis, US | 51 |
| Bozeman, US | 49 |
| Uniwersytet Wrocławskilocation not on record | 49 |
| Missoula, US | 47 |
| Moscow, US | 47 |
| Phoenix, US | 47 |
| Durango, MX | 47 |
| Oulu, FI | 46 |
| Moscow State Universitylocation not on record | 45 |
| Madison, US | 45 |
| EL PASO, US | 42 |
| Saint Louis, US | 41 |
| Jena Microbial Resource Collectionlocation not on record | 41 |
| BAYLUlocation not on record | 40 |
| Texas Lutheran Universitylocation not on record | 40 |
| BFLlocation not on record | 40 |
| St. Paul, US | 39 |
| DBF-NHMDlocation not on record | 37 |
| Salzburg, AT | 37 |
| Lubbock, US | 36 |
| ESP004location not on record | 34 |
| Denton, US | 34 |
| Canberra, AU | 34 |
| ROM007location not on record | 32 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 31 |
| Davis, US | 31 |
| Mount Annan, AU | 31 |
| Brisbane, AU | 30 |
| Québec, CA | 29 |
| Emporia, US | 28 |
| Beijing, CN | 28 |
| Canadian Department of Agriculturelocation not on record | 27 |
| Chapel Hill, US | 27 |
| QAUlocation not on record | 26 |
| Provincia di Livornolocation not on record | 26 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 24 |
| Vancouver, CA | 24 |
| Oskarshamn, SE | 24 |
| ROM023location not on record | 23 |
| Pocatello, US | 23 |
| Logan, US | 23 |
| Görlitz, DE | 23 |
| Burlington, US | 22 |
| University of Alberta Museumslocation not on record | 22 |
| Pittsburg, US | 22 |
| Ann Arbor, US | 22 |
| Karlsruhe, DE | 22 |
| Museo Entomologico de Leonlocation not on record | 21 |
| MeiseBGlocation not on record | 21 |
| San Luis Obispo, US | 21 |
| Trondheim, NO | 20 |
| Kensington, AU | 20 |
| Turku, FI | 17 |
| Grand Junction, US | 16 |
| Williamsburg, US | 16 |
| Zacatecas, MX | 16 |
| Caldwell, US | 16 |
| San Bernardino, US | 16 |
| UChlocation not on record | 15 |
| Severin-McDaniel Insect Collectionlocation not on record | 14 |
| Los Angeles, US | 14 |
| Bern, CH | 13 |
| CASlocation not on record | 13 |
| Tlalnepantla, MX | 13 |
| Adam Mickiewicz University in Poznańlocation not on record | 12 |
| MAlocation not on record | 12 |
| National Institute of Biological Resourceslocation not on record | 12 |
| Córdoba, AR | 11 |
| Tampa, US | 11 |
| Irvine, US | 11 |
| Durango, US | 11 |
| ROM002location not on record | 11 |
| Miami, US | 10 |
| Staten Island, US | 10 |
| KMNlocation not on record | 10 |
| Brussel, BE | 10 |
| Guasave, MX | 10 |
| China Agricultural Universitylocation not on record | 10 |
| US | 10 |
| New Haven, US | 10 |
| South Kensington, GB | 10 |
| Bangkok, TH | 10 |
| Mississippi State, US | 10 |
| Arcata, US | 9 |
| Odawara, JP | 9 |
| Victoria, CA | 9 |
| Northridge, US | 9 |
| Turlock, US | 9 |
| Philadelphia, US | 9 |
| San Angelo, US | 9 |
| GB | 8 |
| Toronto, CA | 8 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 8 |
| Puerto Ayora, EC | 8 |
| Tartu, EE | 8 |
| Kew, GB | 8 |
| Eastern Nevada Landscape Coalitionlocation not on record | 8 |
| Christchurch, NZ | 8 |
| College of the Atlantic, Museumlocation not on record | 8 |
| Pretoria, ZA | 8 |
| Lincoln, US | 8 |
| Barcelona, ES | 8 |
| Montréal, CA | 8 |
| Tempe, US | 8 |
| CICYTEXlocation not on record | 8 |
| Juriquilla, MX | 7 |
| Springfield, US | 7 |
| Uppsala, SE | 7 |
| València, ES | 7 |
| University of New Hampshirelocation not on record | 7 |
| VALElocation not on record | 7 |
| Kuopio, FI | 7 |
| Guangzhou, CN | 7 |
| Orem, US | 6 |
| Armidale, AU | 6 |
| San Isidro, AR | 6 |
| Millersville, US | 6 |
| IDElocation not on record | 6 |
| Fayetteville, US | 6 |
| Jackson, US | 6 |
| Boise, US | 6 |
| Helsinki, FI | 6 |
| Bergen, NO | 6 |
| 云南省思茅市民族传统医药研究所location not on record | 5 |
| Valdosta State Universitylocation not on record | 5 |
| Palmerston, AU | 5 |
| Forssa, FI | 5 |
| Long Beach, US | 5 |
| Portland, US | 5 |
| Vitoria, ES | 5 |
| Salamanca, ES | 5 |
| Stephenville, US | 5 |
| Dekalb, US | 5 |
| Columbia, US | 5 |
| Berlin, DE | 5 |
| Tromso University Museumlocation not on record | 5 |
| Henderson, US | 5 |
| Chengdu, CN | 5 |
| USFSlocation not on record | 5 |
| Hermosillo, MX | 5 |
| Culiacán, MX | 5 |
| Auckland, NZ | 5 |
| Universidad de Antioquia (UdeA)location not on record | 4 |
| H-Dunkellocation not on record | 4 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 4 |
| College Park, US | 4 |
| Austin, US | 4 |
| CJBGlocation not on record | 4 |
| BDBClocation not on record | 4 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 4 |
| Peking Universitylocation not on record | 4 |
| Guilin, CN | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| UNITINSlocation not on record | 4 |
| JBSlocation not on record | 4 |
| US | 4 |
| Mérida, MX | 4 |
| Wuhan, CN | 4 |
| Rocky Mountain Biological Laboratorylocation not on record | 4 |
| Davenport, US | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Granada, ES | 3 |
| Nanjing, CN | 3 |
| Zhengzhou, CN | 3 |
| Macomb, US | 3 |
| AUAlocation not on record | 3 |
| Green Bay, US | 3 |
| Walla Walla, US | 3 |
| Angwin, US | 3 |
| Museum of the Rockieslocation not on record | 3 |
| Feira de Santana, BR | 3 |
| Chicago, US | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Laboratorio de Ictiologialocation not on record | 3 |
| Centre National d'Application des Recherches Pharmaceutiques (CNARP)location not on record | 3 |
| Hudson, US | 3 |
| Hangzhou, CN | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| FUNEDlocation not on record | 3 |
| Knoxville, US | 3 |
| Tuscaloosa, US | 3 |
| Cheney, US | 3 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 3 |
| La Paz, MX | 3 |
| Stockholm, SE | 3 |
| CEPLAClocation not on record | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| Taipei, TW | 3 |
| GAlocation not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Kandalaksha State Nature Reservelocation not on record | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| BClocation not on record | 2 |
| San José, CR | 2 |
| Antiguo Cuscatlán, SV | 2 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 2 |
| Santa Cruz, US | 2 |
| Nagano City, JP | 2 |
| Morgantown, US | 2 |
| Giardini Botanici Hanburylocation not on record | 2 |
| IWEP FEB RASlocation not on record | 2 |
| Acadia Universitylocation not on record | 2 |
| Durban, ZA | 2 |
| Nijmegen, NL | 2 |
| Keene State Universitylocation not on record | 2 |
| Cape Town, ZA | 2 |
| Mlocation not on record | 2 |
| Kunming, CN | 2 |
| New Brunswick, US | 2 |
| Université de Bordeauxlocation not on record | 2 |
| Edmonton, CA | 2 |
| Whitewater, US | 2 |
| Wuhan, CN | 2 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 2 |
| Ilhéus, BR | 2 |
| UFBAlocation not on record | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| Stockholm, SE | 2 |
| ENTClocation not on record | 2 |
| Beijing Normal Universitylocation not on record | 2 |
| Facultad de Zootecnia y Ecología, Universidad Autónoma de Chihuahualocation not on record | 2 |
| Frauenfeld, CH | 2 |
| Orto botanico dell'Università degli Studi di Catanialocation not on record | 2 |
| Bureau of Land Managementlocation not on record | 2 |
| Foz do Iguaçu, BR | 2 |
| BRNUlocation not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Sanda, JP | 2 |
| Kirksville, US | 2 |
| Université Lavallocation not on record | 2 |
| Tallinn, EE | 2 |
| Chicago, US | 2 |
| Bend, US | 2 |
| Riobamba, EC | 2 |
| Tacoma, US | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| San Sebastián, ES | 2 |
| TAIElocation not on record | 2 |
| PRClocation not on record | 2 |
| Xining, CN | 2 |
| UFERSAlocation not on record | 2 |
| Little Rock, US | 2 |
| Pamplona, ES | 1 |
| National Biodiversity Institute, Costa Ricalocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Taipei, TW | 1 |
| Arizona Western Collegelocation not on record | 1 |
| Minia, EG | 1 |
| Henderson State Universitylocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| UFPIlocation not on record | 1 |
| Dover, US | 1 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 1 |
| Dhaka, BD | 1 |
| Changsha, CN | 1 |
| Tepatitlán de Morelos, MX | 1 |
| Porvoo, FI | 1 |
| Smithfield, AU | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Ciudad Autónoma de Buenos Aires, AR | 1 |
| Yunnan Universitylocation not on record | 1 |
| Bando, JP | 1 |
| FLASlocation not on record | 1 |
| 1 | |
| UBClocation not on record | 1 |
| EAlocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| San Francisco de Campeche, MX | 1 |
| Criciúma, BR | 1 |
| Bogotá, D.C., CO | 1 |
| Instituto de Investigaciones Botánicas y Zoológicas - Prof. Rafael M. Moscoso, Universidad Autónoma de Santo Domingolocation not on record | 1 |
| SCAUlocation not on record | 1 |
| UnBlocation not on record | 1 |
| Masindi, UG | 1 |
| Cslocation not on record | 1 |
| Alicante, ES | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Teresina, BR | 1 |
| UFPElocation not on record | 1 |
| San Jose, US | 1 |
| INMAlocation not on record | 1 |
| Wellington, NZ | 1 |
| Parkville, AU | 1 |
| Firenze, IT | 1 |
| TAFORI-LSRClocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Lanzhou, CN | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Knox Collegelocation not on record | 1 |
| Ensenada, MX | 1 |
| Mount Pleasant, US | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| Jefferson City, US | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Universidad Católica de Oriente (UCO)location not on record | 1 |
| CMULlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| Pelotas, BR | 1 |
| Madrid, ES | 1 |
| Laboratory of Palaeontologylocation not on record | 1 |
| Washington, US | 1 |
| PUC-RSlocation not on record | 1 |
| Mérida, MX | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| WINlocation not on record | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| FPMZBlocation not on record | 1 |
| POL003location not on record | 1 |
| UNESP, Campus São José Rio Prêtolocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Santa Teresa, BR | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| USP-IBlocation not on record | 1 |
| UNESClocation not on record | 1 |
| Sion, CH | 1 |
| Fredericksburg, US | 1 |
| GJOlocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| Saint John, CA | 1 |
| Ivano-Frankove, UA | 1 |
| Altos de Pipe, VE | 1 |
| Clemson, US | 1 |
| Chiba, JP | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| INFlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| Norfolk, US | 1 |
| Johnson City, US | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Fullerton, US | 1 |
| Université du Lomélocation not on record | 1 |
| UFMGlocation not on record | 1 |
| US | 1 |
| KIWElocation not on record | 1 |
| Urumqi, CN | 1 |
| UniKSlocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| DASSHlocation not on record | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| 东北师范大学自然博物馆location not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| GZUlocation not on record | 1 |
| Mexico City, MX | 1 |
| Seropédica, BR | 1 |
| Campo Mourão, BR | 1 |
| Shinshu Universitylocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| UTFPR-CPlocation not on record | 1 |
| Chicago, US | 1 |
| Chaguaramas, TT | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Corrientes, AR | 1 |
393 institutions · 7 299 of 8 003 vouchered records shown · 682 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA472 detections
Where the DNA of Helianthus annuus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found472
Studies independent surveys5
Countries9
Verifiable raw sequence linked7
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 472 detections have coordinates
Open the map9 countries0
ChaparralGrowing roadside in gravelly soil w/ euphorb…Mexico, Gulf of
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature18.0 °C 0.977–30.0
pH5.60 3.30–9.20
Conductivity60.0 µS/cm 10.0–117,000
Salinity35.8 PSU 26.5–35.9
Dissolved oxygen7.30 mg/L 6.45–7.81
Turbidity1.01 NTU
Organic carbon1.97 % 0.005–15.0
Water content20.7 % 0.962–84.0
Nitrate-N5.00 mg/kg 0.5–284
Phosphorus14.0 mg/kg 1.00–590
Clay15.6 % 0.99–75.9
Sand66.9 % 2.00–99.1
Depth0 m 0–5,460
MarineCoastal waterSoilPelagicSedimentTenosolsChromosolsKandosolDermosolSodosolRudosol
379 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.0 °C 7.90–22.6
Seasonal swing summer↔winter12.2 °C
Max temp (day)19.3 °C 12.0–27.9
Min temp (night)9.20 °C 4.00–17.9
Precipitation64.4 mm/mo 28.0–123
Air humidity58.2 % 51.9–64.7
Moisture balance-27.5 mm/mo -107–65.4
Vapour deficit698 Pa 367–1,251
Wind speed2.90 m/s 2.00–5.00
Cloud cover22.4 % 9.70–35.7
CHELSA 1981–2010, ~9 km grid, at location & month of 448 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.